Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2731538..2731656 | Replicon | chromosome |
Accession | NC_015224 | ||
Organism | Yersinia enterocolitica subsp. palearctica 105.5R(r) |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2731540..2731634 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2731538..2731656 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
YE105_RS12505 | 2727366..2727818 | + | 453 | WP_005163578.1 | phage tail protein | - |
YE105_RS12510 | 2727815..2728957 | + | 1143 | WP_013649998.1 | phage late control D family protein | - |
YE105_RS21720 | 2729050..2729271 | + | 222 | WP_071822716.1 | DNA-binding transcriptional regulator | - |
YE105_RS12515 | 2729356..2730171 | - | 816 | WP_005163581.1 | hypothetical protein | - |
YE105_RS12520 | 2730412..2731482 | + | 1071 | WP_201773596.1 | tyrosine-type recombinase/integrase | - |
- | 2731538..2731656 | + | 119 | - | - | Antitoxin |
- | 2731540..2731634 | - | 95 | - | - | Toxin |
YE105_RS12525 | 2731809..2732150 | - | 342 | WP_005163587.1 | YebY family protein | - |
YE105_RS12530 | 2732247..2733131 | - | 885 | WP_005163602.1 | copper homeostasis membrane protein CopD | - |
YE105_RS12535 | 2733133..2733519 | - | 387 | WP_005170441.1 | CopC domain-containing protein YobA | - |
YE105_RS12540 | 2733912..2734421 | - | 510 | WP_013650000.1 | non-heme ferritin | - |
YE105_RS12545 | 2734805..2735038 | + | 234 | WP_004389928.1 | DNA polymerase III subunit theta | - |
YE105_RS12550 | 2735088..2736031 | - | 944 | Protein_2413 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2722194..2737203 | 15009 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 95 bp
>T25147 NC_015224:c2731634-2731540 [Yersinia enterocolitica subsp. palearctica 105.5R(r)]
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTTTTTTT
AACAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATCGT
ATTCGGTCTTTTTTT
Antitoxin
Download Length: 119 bp
>AT25147 NC_015224:2731538-2731656 [Yersinia enterocolitica subsp. palearctica 105.5R(r)]
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAACGTAGGCTTGTTCAGCCATACTCTTTAAGAGTAG