Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2029707..2029847 | Replicon | chromosome |
Accession | NZ_CP100765 | ||
Organism | Serratia nematodiphila strain SASK3000 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2029751..2029847 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2029707..2029847 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NLX84_RS09600 (NLX84_09600) | 2024975..2025370 | + | 396 | WP_033633335.1 | RidA family protein | - |
NLX84_RS09605 (NLX84_09605) | 2025527..2026480 | + | 954 | WP_004928848.1 | prolyl aminopeptidase | - |
NLX84_RS09610 (NLX84_09610) | 2026512..2026742 | - | 231 | WP_016928156.1 | DNA polymerase III subunit theta | - |
NLX84_RS09615 (NLX84_09615) | 2027087..2027605 | + | 519 | WP_015377481.1 | non-heme ferritin | - |
NLX84_RS09620 (NLX84_09620) | 2027898..2028314 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
NLX84_RS09625 (NLX84_09625) | 2028317..2029198 | + | 882 | WP_033633334.1 | copper homeostasis membrane protein CopD | - |
NLX84_RS09630 (NLX84_09630) | 2029268..2029609 | + | 342 | WP_033633333.1 | YebY family protein | - |
- | 2029707..2029847 | - | 141 | - | - | Antitoxin |
- | 2029751..2029847 | + | 97 | - | - | Toxin |
NLX84_RS09635 (NLX84_09635) | 2029893..2030981 | - | 1089 | WP_135638008.1 | tyrosine-type recombinase/integrase | - |
NLX84_RS09640 (NLX84_09640) | 2031101..2031319 | - | 219 | WP_071844562.1 | ogr/Delta-like zinc finger family protein | - |
NLX84_RS09645 (NLX84_09645) | 2031393..2032490 | - | 1098 | WP_135638010.1 | phage late control D family protein | - |
NLX84_RS09650 (NLX84_09650) | 2032487..2032951 | - | 465 | WP_135638012.1 | phage tail protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2026512..2065654 | 39142 | |
- | inside | Prophage | - | - | 2021689..2065654 | 43965 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T251394 NZ_CP100765:2029751-2029847 [Serratia nematodiphila]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT251394 NZ_CP100765:c2029847-2029707 [Serratia nematodiphila]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG