Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2032282..2032425 | Replicon | chromosome |
| Accession | NZ_CP100747 | ||
| Organism | Salmonella enterica subsp. enterica serovar Montevideo strain R17.4849 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2032320..2032423 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2032282..2032425 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL707_RS09930 | 2028706..2029404 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
| NL707_RS09935 | 2029428..2030084 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| NL707_RS09940 | 2030192..2030422 | - | 231 | WP_000856225.1 | DNA polymerase III subunit theta | - |
| NL707_RS09945 | 2030560..2030934 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NL707_RS09950 | 2030935..2031810 | + | 876 | WP_000979696.1 | copper homeostasis membrane protein CopD | - |
| NL707_RS09955 | 2031827..2032180 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2032282..2032425 | - | 144 | - | - | Antitoxin |
| - | 2032320..2032423 | + | 104 | - | - | Toxin |
| NL707_RS09960 | 2032554..2033395 | - | 842 | Protein_1943 | tyrosine-type recombinase/integrase | - |
| NL707_RS09965 | 2033501..2033857 | + | 357 | WP_000003144.1 | hypothetical protein | - |
| NL707_RS09970 | 2033781..2034440 | + | 660 | WP_223152472.1 | DUF4376 domain-containing protein | - |
| NL707_RS09975 | 2034451..2034828 | + | 378 | WP_001277619.1 | DUF1353 domain-containing protein | - |
| NL707_RS09980 | 2034832..2034942 | + | 111 | Protein_1947 | tail fiber assembly protein | - |
| NL707_RS09985 | 2035033..2035218 | - | 186 | WP_071585801.1 | PagK family vesicle-borne virulence factor | - |
| NL707_RS09990 | 2035464..2035637 | - | 174 | Protein_1949 | tail fiber assembly protein | - |
| NL707_RS09995 | 2035657..2036427 | - | 771 | WP_000758582.1 | transporter substrate-binding domain-containing protein | - |
| NL707_RS10000 | 2036491..2036595 | + | 105 | Protein_1951 | DUF4113 domain-containing protein | - |
| NL707_RS10005 | 2036918..2037046 | + | 129 | Protein_1952 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2026620..2067656 | 41036 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251342 NZ_CP100747:2032320-2032423 [Salmonella enterica subsp. enterica serovar Montevideo]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT251342 NZ_CP100747:c2032425-2032282 [Salmonella enterica subsp. enterica serovar Montevideo]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
