Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2009359..2009504 | Replicon | chromosome |
| Accession | NZ_CP100744 | ||
| Organism | Salmonella enterica subsp. enterica serovar Newport strain R18.0234 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2009399..2009502 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2009359..2009504 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| FGU68_RS09665 | 2005785..2006483 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| FGU68_RS09670 | 2006507..2007163 | - | 657 | WP_000100254.1 | carbon-nitrogen hydrolase family protein | - |
| FGU68_RS09675 | 2007271..2007501 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| FGU68_RS09680 | 2007639..2008013 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
| FGU68_RS09685 | 2008014..2008889 | + | 876 | WP_000979686.1 | copper homeostasis membrane protein CopD | - |
| FGU68_RS09690 | 2008906..2009259 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2009359..2009504 | - | 146 | - | - | Antitoxin |
| - | 2009399..2009502 | + | 104 | - | - | Toxin |
| FGU68_RS09695 | 2009632..2010711 | - | 1080 | WP_000087646.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| FGU68_RS09700 | 2010741..2011736 | - | 996 | Protein_1894 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| FGU68_RS09705 | 2011884..2012132 | + | 249 | Protein_1895 | glycoside hydrolase family 19 protein | - |
| FGU68_RS09710 | 2012129..2012663 | + | 535 | Protein_1896 | DUF2514 domain-containing protein | - |
| FGU68_RS09715 | 2012920..2013087 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| FGU68_RS09720 | 2013152..2013340 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| FGU68_RS09725 | 2013395..2013655 | + | 261 | Protein_1899 | DUF1441 family protein | - |
| FGU68_RS09730 | 2013870..2014214 | + | 345 | Protein_1900 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2003697..2036269 | 32572 | |
| - | inside | Prophage | - | sopE2 | 1987488..2049194 | 61706 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251326 NZ_CP100744:2009399-2009502 [Salmonella enterica subsp. enterica serovar Newport]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251326 NZ_CP100744:c2009504-2009359 [Salmonella enterica subsp. enterica serovar Newport]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
