Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2703494..2703637 | Replicon | chromosome |
| Accession | NZ_CP100736 | ||
| Organism | Salmonella enterica subsp. enterica serovar Agona strain R18.1477 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2703496..2703599 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2703494..2703637 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL742_RS13095 | 2698916..2699185 | + | 270 | WP_077905753.1 | hypothetical protein | - |
| NL742_RS13100 | 2699351..2699491 | + | 141 | WP_000489598.1 | hypothetical protein | - |
| NL742_RS13105 | 2699637..2700179 | - | 543 | Protein_2565 | IS256 family transposase | - |
| NL742_RS13110 | 2700199..2700291 | - | 93 | WP_231923105.1 | hypothetical protein | - |
| NL742_RS13115 | 2700321..2702741 | - | 2421 | WP_024144813.1 | type III secretion system effector SspH3 | - |
| NL742_RS13120 | 2702914..2702997 | - | 84 | Protein_2568 | phage tail protein | - |
| NL742_RS13125 | 2703009..2703356 | + | 348 | Protein_2569 | tyrosine-type recombinase/integrase | - |
| - | 2703494..2703637 | + | 144 | - | - | Antitoxin |
| - | 2703496..2703599 | - | 104 | - | - | Toxin |
| NL742_RS13130 | 2703739..2704092 | - | 354 | WP_000722368.1 | YebY family protein | - |
| NL742_RS13135 | 2704109..2704984 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| NL742_RS13140 | 2704985..2705359 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NL742_RS13145 | 2705497..2705727 | + | 231 | WP_000856227.1 | DNA polymerase III subunit theta | - |
| NL742_RS13150 | 2705835..2706491 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| NL742_RS13155 | 2706515..2707213 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2699637..2700314 | 677 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251287 NZ_CP100736:c2703599-2703496 [Salmonella enterica subsp. enterica serovar Agona]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT251287 NZ_CP100736:2703494-2703637 [Salmonella enterica subsp. enterica serovar Agona]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
