Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2058860..2059005 | Replicon | chromosome |
| Accession | NZ_CP100728 | ||
| Organism | Salmonella enterica subsp. enterica serovar Blockley strain R17.0776 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2058900..2059003 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2058860..2059005 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL731_RS09940 | 2055286..2055984 | - | 699 | WP_064047430.1 | exodeoxyribonuclease X | - |
| NL731_RS09945 | 2056008..2056664 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| NL731_RS09950 | 2056772..2057002 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL731_RS09955 | 2057140..2057514 | + | 375 | WP_064047429.1 | CopC domain-containing protein YobA | - |
| NL731_RS09960 | 2057515..2058390 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| NL731_RS09965 | 2058407..2058760 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2058860..2059005 | - | 146 | - | - | Antitoxin |
| - | 2058900..2059003 | + | 104 | - | - | Toxin |
| NL731_RS09970 | 2059134..2060057 | - | 924 | Protein_1949 | tyrosine-type recombinase/integrase | - |
| NL731_RS09975 | 2060321..2060782 | - | 462 | Protein_1950 | DNA breaking-rejoining protein | - |
| NL731_RS09980 | 2060771..2060962 | + | 192 | Protein_1951 | glycoside hydrolase family 19 protein | - |
| NL731_RS09985 | 2061016..2061549 | + | 534 | WP_064047437.1 | DUF2514 domain-containing protein | - |
| NL731_RS09990 | 2061806..2061973 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NL731_RS09995 | 2062038..2062229 | - | 192 | WP_064047438.1 | hypothetical protein | - |
| NL731_RS10000 | 2062284..2062775 | + | 492 | WP_000348543.1 | DUF1441 family protein | - |
| NL731_RS10005 | 2062762..2063329 | + | 568 | Protein_1956 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2053198..2100735 | 47537 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251243 NZ_CP100728:2058900-2059003 [Salmonella enterica subsp. enterica serovar Blockley]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251243 NZ_CP100728:c2059005-2058860 [Salmonella enterica subsp. enterica serovar Blockley]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG