Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2733264..2733409 | Replicon | chromosome |
| Accession | NZ_CP100724 | ||
| Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain R17.1476 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2733266..2733369 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2733264..2733409 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL714_RS13520 | 2728464..2728682 | - | 219 | WP_001524708.1 | hypothetical protein | - |
| NL714_RS13520 | 2728464..2728682 | - | 219 | WP_001524708.1 | hypothetical protein | - |
| NL714_RS13525 | 2728984..2729082 | - | 99 | WP_223151200.1 | hypothetical protein | - |
| NL714_RS13525 | 2728984..2729082 | - | 99 | WP_223151200.1 | hypothetical protein | - |
| NL714_RS13530 | 2729401..2731380 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
| NL714_RS13530 | 2729401..2731380 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
| NL714_RS13535 | 2731794..2732072 | + | 279 | WP_001575998.1 | excisionase | - |
| NL714_RS13535 | 2731794..2732072 | + | 279 | WP_001575998.1 | excisionase | - |
| NL714_RS13540 | 2732047..2733126 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| NL714_RS13540 | 2732047..2733126 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 2733264..2733409 | + | 146 | - | - | Antitoxin |
| - | 2733264..2733409 | + | 146 | - | - | Antitoxin |
| - | 2733266..2733369 | - | 104 | - | - | Toxin |
| - | 2733266..2733369 | - | 104 | - | - | Toxin |
| NL714_RS13545 | 2733509..2733862 | - | 354 | WP_000722370.1 | YebY family protein | - |
| NL714_RS13545 | 2733509..2733862 | - | 354 | WP_000722370.1 | YebY family protein | - |
| NL714_RS13550 | 2733879..2734754 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| NL714_RS13550 | 2733879..2734754 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| NL714_RS13555 | 2734755..2735129 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NL714_RS13555 | 2734755..2735129 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NL714_RS13560 | 2735267..2735497 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL714_RS13560 | 2735267..2735497 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL714_RS13565 | 2735605..2736261 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| NL714_RS13565 | 2735605..2736261 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| NL714_RS13570 | 2736285..2736983 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
| NL714_RS13570 | 2736285..2736983 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2692291..2739071 | 46780 | |
| - | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2679365..2755279 | 75914 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251223 NZ_CP100724:c2733369-2733266 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251223 NZ_CP100724:2733264-2733409 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
