Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2749396..2749539 | Replicon | chromosome |
| Accession | NZ_CP100718 | ||
| Organism | Salmonella enterica subsp. enterica serovar Weltevreden strain R17.4942 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2749398..2749501 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2749396..2749539 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL732_RS13460 | 2744778..2744906 | - | 129 | Protein_2636 | helix-turn-helix domain-containing protein | - |
| NL732_RS13465 | 2745229..2745327 | - | 99 | Protein_2637 | DUF4113 domain-containing protein | - |
| NL732_RS13470 | 2745397..2746167 | + | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| NL732_RS13475 | 2746265..2746360 | + | 96 | WP_024133706.1 | hypothetical protein | - |
| NL732_RS13480 | 2746885..2746989 | - | 105 | Protein_2640 | tail fiber assembly protein | - |
| NL732_RS13485 | 2747038..2747370 | - | 333 | WP_031617877.1 | DUF1353 domain-containing protein | - |
| NL732_RS13490 | 2747476..2747547 | - | 72 | Protein_2642 | hypothetical protein | - |
| NL732_RS13495 | 2747802..2748008 | - | 207 | Protein_2643 | phage tail protein | - |
| NL732_RS13500 | 2747962..2748318 | - | 357 | WP_015632906.1 | hypothetical protein | - |
| NL732_RS13505 | 2748446..2749267 | + | 822 | Protein_2645 | tyrosine-type recombinase/integrase | - |
| - | 2749396..2749539 | + | 144 | - | - | Antitoxin |
| - | 2749398..2749501 | - | 104 | - | - | Toxin |
| NL732_RS13510 | 2749641..2749994 | - | 354 | WP_000722368.1 | YebY family protein | - |
| NL732_RS13515 | 2750011..2750886 | - | 876 | WP_000979688.1 | copper homeostasis membrane protein CopD | - |
| NL732_RS13520 | 2750887..2751261 | - | 375 | WP_000168397.1 | CopC domain-containing protein YobA | - |
| NL732_RS13525 | 2751399..2751629 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL732_RS13530 | 2751737..2752393 | + | 657 | WP_254519623.1 | carbon-nitrogen hydrolase family protein | - |
| NL732_RS13535 | 2752417..2753115 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2742287..2755201 | 12914 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251198 NZ_CP100718:c2749501-2749398 [Salmonella enterica subsp. enterica serovar Weltevreden]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT251198 NZ_CP100718:2749396-2749539 [Salmonella enterica subsp. enterica serovar Weltevreden]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
