Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2027596..2027741 | Replicon | chromosome |
| Accession | NZ_CP100710 | ||
| Organism | Salmonella enterica subsp. enterica serovar Blockley strain R18.0186 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2027636..2027739 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2027596..2027741 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL733_RS09710 | 2024022..2024720 | - | 699 | WP_064047430.1 | exodeoxyribonuclease X | - |
| NL733_RS09715 | 2024744..2025400 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| NL733_RS09720 | 2025508..2025738 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL733_RS09725 | 2025876..2026250 | + | 375 | WP_064047429.1 | CopC domain-containing protein YobA | - |
| NL733_RS09730 | 2026251..2027126 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| NL733_RS09735 | 2027143..2027496 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2027596..2027741 | - | 146 | - | - | Antitoxin |
| - | 2027636..2027739 | + | 104 | - | - | Toxin |
| NL733_RS09740 | 2027870..2028793 | - | 924 | Protein_1903 | tyrosine-type recombinase/integrase | - |
| NL733_RS09745 | 2029057..2029518 | - | 462 | Protein_1904 | DNA breaking-rejoining protein | - |
| NL733_RS09750 | 2029507..2029698 | + | 192 | Protein_1905 | glycoside hydrolase family 19 protein | - |
| NL733_RS09755 | 2029752..2030285 | + | 534 | WP_064047437.1 | DUF2514 domain-containing protein | - |
| NL733_RS09760 | 2030542..2030709 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NL733_RS09765 | 2030774..2030965 | - | 192 | WP_064047438.1 | hypothetical protein | - |
| NL733_RS09770 | 2031020..2031511 | + | 492 | WP_000348543.1 | DUF1441 family protein | - |
| NL733_RS09775 | 2031498..2032065 | + | 568 | Protein_1910 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2005726..2069471 | 63745 | |
| - | inside | Prophage | - | sopE2 | 2021934..2056545 | 34611 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251159 NZ_CP100710:2027636-2027739 [Salmonella enterica subsp. enterica serovar Blockley]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251159 NZ_CP100710:c2027741-2027596 [Salmonella enterica subsp. enterica serovar Blockley]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
