Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2745700..2745843 | Replicon | chromosome |
| Accession | NZ_CP100695 | ||
| Organism | Salmonella enterica subsp. enterica serovar Weltevreden strain R18.0830 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2745702..2745805 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2745700..2745843 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL711_RS13520 | 2741082..2741210 | - | 129 | Protein_2647 | helix-turn-helix domain-containing protein | - |
| NL711_RS13525 | 2741533..2741631 | - | 99 | Protein_2648 | DUF4113 domain-containing protein | - |
| NL711_RS13530 | 2741701..2742471 | + | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| NL711_RS13535 | 2742569..2742664 | + | 96 | WP_024133706.1 | hypothetical protein | - |
| NL711_RS13540 | 2743189..2743293 | - | 105 | Protein_2651 | tail fiber assembly protein | - |
| NL711_RS13545 | 2743342..2743674 | - | 333 | WP_031617877.1 | DUF1353 domain-containing protein | - |
| NL711_RS13550 | 2743780..2743851 | - | 72 | Protein_2653 | hypothetical protein | - |
| NL711_RS13555 | 2744106..2744312 | - | 207 | Protein_2654 | phage tail protein | - |
| NL711_RS13560 | 2744266..2744622 | - | 357 | WP_015632906.1 | hypothetical protein | - |
| NL711_RS13565 | 2744750..2745571 | + | 822 | Protein_2656 | tyrosine-type recombinase/integrase | - |
| - | 2745700..2745843 | + | 144 | - | - | Antitoxin |
| - | 2745702..2745805 | - | 104 | - | - | Toxin |
| NL711_RS13570 | 2745945..2746298 | - | 354 | WP_000722368.1 | YebY family protein | - |
| NL711_RS13575 | 2746315..2747190 | - | 876 | WP_000979688.1 | copper homeostasis membrane protein CopD | - |
| NL711_RS13580 | 2747191..2747565 | - | 375 | WP_000168397.1 | CopC domain-containing protein YobA | - |
| NL711_RS13585 | 2747703..2747933 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL711_RS13590 | 2748041..2748697 | + | 657 | WP_254519623.1 | carbon-nitrogen hydrolase family protein | - |
| NL711_RS13595 | 2748721..2749419 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2726010..2769028 | 43018 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251070 NZ_CP100695:c2745805-2745702 [Salmonella enterica subsp. enterica serovar Weltevreden]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT251070 NZ_CP100695:2745700-2745843 [Salmonella enterica subsp. enterica serovar Weltevreden]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG