Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1985440..1985583 | Replicon | chromosome |
| Accession | NZ_CP100693 | ||
| Organism | Salmonella enterica subsp. enterica serovar London strain R18.1595 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1985479..1985581 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1985440..1985583 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL712_RS09485 | 1981864..1982562 | - | 699 | WP_023255939.1 | exodeoxyribonuclease X | - |
| NL712_RS09490 | 1982586..1983242 | - | 657 | WP_023245437.1 | carbon-nitrogen hydrolase family protein | - |
| NL712_RS09495 | 1983350..1983580 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL712_RS09500 | 1983718..1984092 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NL712_RS09505 | 1984093..1984968 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| NL712_RS09510 | 1984985..1985338 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1985440..1985583 | - | 144 | - | - | Antitoxin |
| - | 1985479..1985581 | + | 103 | - | - | Toxin |
| NL712_RS09515 | 1985721..1986800 | - | 1080 | WP_058107134.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| NL712_RS09520 | 1986833..1987984 | - | 1152 | Protein_1859 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| NL712_RS09525 | 1987973..1988164 | + | 192 | Protein_1860 | glycoside hydrolase family 19 protein | - |
| NL712_RS09530 | 1988218..1988751 | + | 534 | WP_023256014.1 | DUF2514 domain-containing protein | - |
| NL712_RS09535 | 1989008..1989175 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NL712_RS09540 | 1989240..1989428 | - | 189 | WP_001034748.1 | hypothetical protein | - |
| NL712_RS09545 | 1989483..1989743 | + | 261 | Protein_1864 | DUF1441 family protein | - |
| NL712_RS09550 | 1989745..1989960 | + | 216 | Protein_1865 | shikimate transporter | - |
| NL712_RS09555 | 1989970..1990257 | + | 288 | Protein_1866 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1962253..2005752 | 43499 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T251053 NZ_CP100693:1985479-1985581 [Salmonella enterica subsp. enterica serovar London]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT251053 NZ_CP100693:c1985583-1985440 [Salmonella enterica subsp. enterica serovar London]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG