Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2499360..2499503 | Replicon | chromosome |
Accession | NZ_CP100670 | ||
Organism | Salmonella enterica subsp. enterica serovar Mbandaka strain R17.0904 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2499362..2499465 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2499360..2499503 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NL713_RS12005 | 2494814..2495083 | + | 270 | WP_077907250.1 | hypothetical protein | - |
NL713_RS12010 | 2495249..2495389 | + | 141 | WP_031615664.1 | hypothetical protein | - |
NL713_RS12015 | 2495535..2496063 | - | 529 | Protein_2346 | transposase | - |
NL713_RS12020 | 2496083..2496175 | - | 93 | WP_230855586.1 | hypothetical protein | - |
NL713_RS12025 | 2496205..2498625 | - | 2421 | WP_024149295.1 | type III secretion system effector SspH3 | - |
NL713_RS12030 | 2498799..2498882 | - | 84 | Protein_2349 | phage tail protein | - |
NL713_RS12035 | 2498894..2499241 | + | 348 | Protein_2350 | tyrosine-type recombinase/integrase | - |
- | 2499360..2499503 | + | 144 | - | - | Antitoxin |
- | 2499362..2499465 | - | 104 | - | - | Toxin |
NL713_RS12040 | 2499606..2499959 | - | 354 | WP_017441954.1 | YebY family protein | - |
NL713_RS12045 | 2499976..2500851 | - | 876 | WP_017441953.1 | copper homeostasis membrane protein CopD | - |
NL713_RS12050 | 2500852..2501226 | - | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
NL713_RS12055 | 2501364..2501594 | + | 231 | WP_017441952.1 | DNA polymerase III subunit theta | - |
NL713_RS12060 | 2501702..2502358 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
NL713_RS12065 | 2502382..2503080 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 2495535..2495873 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T250954 NZ_CP100670:c2499465-2499362 [Salmonella enterica subsp. enterica serovar Mbandaka]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT250954 NZ_CP100670:2499360-2499503 [Salmonella enterica subsp. enterica serovar Mbandaka]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAAGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAAGTTTTCCAGTTTG