Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1795357..1795502 | Replicon | chromosome |
Accession | NZ_CP100666 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain R18.1630 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1795397..1795500 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1795357..1795502 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NL709_RS08585 | 1791783..1792481 | - | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
NL709_RS08590 | 1792505..1793161 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
NL709_RS08595 | 1793269..1793499 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
NL709_RS08600 | 1793637..1794011 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
NL709_RS08605 | 1794012..1794887 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
NL709_RS08610 | 1794904..1795257 | + | 354 | WP_000722370.1 | YebY family protein | - |
- | 1795357..1795502 | - | 146 | - | - | Antitoxin |
- | 1795397..1795500 | + | 104 | - | - | Toxin |
NL709_RS08615 | 1795640..1796719 | - | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
NL709_RS08620 | 1796694..1796972 | - | 279 | WP_001575998.1 | excisionase | - |
NL709_RS08625 | 1797386..1799365 | + | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
NL709_RS08630 | 1799684..1799782 | + | 99 | WP_223151200.1 | hypothetical protein | - |
NL709_RS08635 | 1800084..1800302 | + | 219 | WP_001524708.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sodCI / sopE2 / sopE2 | 1775358..1836475 | 61117 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T250927 NZ_CP100666:1795397-1795500 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT250927 NZ_CP100666:c1795502-1795357 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG