Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2487395..2487505 | Replicon | chromosome |
Accession | NC_014837 | ||
Organism | Pantoea sp. At-9b |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2487399..2487499 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2487395..2487505 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PAT9B_RS11510 | 2482918..2483268 | + | 351 | WP_013509438.1 | GPW/gp25 family protein | - |
PAT9B_RS11515 | 2483273..2484181 | + | 909 | Protein_2257 | baseplate assembly protein | - |
PAT9B_RS30615 | 2484275..2484445 | + | 171 | WP_150105820.1 | phage tail protein | - |
PAT9B_RS11525 | 2485113..2485376 | + | 264 | WP_013509439.1 | helix-turn-helix domain-containing protein | - |
PAT9B_RS11530 | 2485425..2485832 | - | 408 | WP_013509440.1 | type II toxin-antitoxin system HicB family antitoxin | - |
PAT9B_RS11535 | 2486392..2486577 | + | 186 | WP_013509441.1 | hypothetical protein | - |
PAT9B_RS11540 | 2487011..2487319 | + | 309 | WP_049792189.1 | hypothetical protein | - |
- | 2487395..2487505 | + | 111 | - | - | Antitoxin |
- | 2487399..2487499 | - | 101 | - | - | Toxin |
PAT9B_RS11545 | 2487640..2487987 | - | 348 | WP_041525960.1 | YebY family protein | - |
PAT9B_RS11550 | 2488021..2488902 | - | 882 | WP_013509443.1 | copper homeostasis membrane protein CopD | - |
PAT9B_RS11555 | 2488902..2489279 | - | 378 | WP_013509444.1 | copper homeostasis periplasmic binding protein CopC | - |
PAT9B_RS11560 | 2489433..2489663 | + | 231 | WP_013509445.1 | DNA polymerase III subunit theta | - |
PAT9B_RS11565 | 2489667..2490335 | + | 669 | WP_013509446.1 | exodeoxyribonuclease X | - |
PAT9B_RS11570 | 2490329..2492392 | - | 2064 | WP_013509447.1 | prolyl oligopeptidase family serine peptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | pla | 2457284..2517007 | 59723 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 101 bp
>T25023 NC_014837:c2487499-2487399 [Pantoea sp. At-9b]
GGCAAGGCGACCTCGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCAAAGAGCCATTTCCCTGGACCGGATACAGG
AATCGTATTCGGTCTTTTTTT
GGCAAGGCGACCTCGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCAAAGAGCCATTTCCCTGGACCGGATACAGG
AATCGTATTCGGTCTTTTTTT
Antitoxin
Download Length: 111 bp
>AT25023 NC_014837:2487395-2487505 [Pantoea sp. At-9b]
AGACAAAAAAAGACCGAATACGATTCCTGTATCCGGTCCAGGGAAATGGCTCTTTGAGAGCCGTGCGCTAAAAGTTGGCA
TTAATGCAGGCGAGGTCGCCTTGCCTTTTAA
AGACAAAAAAAGACCGAATACGATTCCTGTATCCGGTCCAGGGAAATGGCTCTTTGAGAGCCGTGCGCTAAAAGTTGGCA
TTAATGCAGGCGAGGTCGCCTTGCCTTTTAA