Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2693498..2693643 | Replicon | chromosome |
Accession | NZ_CP099973 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain SE006 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2693500..2693603 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2693498..2693643 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NHL55_RS13240 | 2688698..2688916 | - | 219 | WP_001524708.1 | hypothetical protein | - |
NHL55_RS13245 | 2689218..2689316 | - | 99 | WP_223151200.1 | hypothetical protein | - |
NHL55_RS13250 | 2689635..2691614 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
NHL55_RS13255 | 2692028..2692306 | + | 279 | WP_001575998.1 | excisionase | - |
NHL55_RS13260 | 2692281..2693360 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2693498..2693643 | + | 146 | - | - | Antitoxin |
- | 2693500..2693603 | - | 104 | - | - | Toxin |
NHL55_RS13265 | 2693743..2694096 | - | 354 | WP_000722370.1 | YebY family protein | - |
NHL55_RS13270 | 2694113..2694988 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
NHL55_RS13275 | 2694989..2695363 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
NHL55_RS13280 | 2695501..2695731 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
NHL55_RS13285 | 2695839..2696495 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
NHL55_RS13290 | 2696519..2697217 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2652525..2715513 | 62988 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T250003 NZ_CP099973:c2693603-2693500 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT250003 NZ_CP099973:2693498-2693643 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG