Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1364612..1364744 | Replicon | chromosome |
Accession | NZ_CP099535 | ||
Organism | Pantoea ananatis strain JT1-188 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1364647..1364744 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1364612..1364744 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NG826_RS06390 (NG826_06380) | 1359795..1361867 | + | 2073 | WP_263794003.1 | prolyl oligopeptidase family serine peptidase | - |
NG826_RS06395 (NG826_06385) | 1361851..1362522 | - | 672 | WP_263794004.1 | exodeoxyribonuclease X | - |
NG826_RS06400 (NG826_06390) | 1362522..1362752 | - | 231 | WP_019105100.1 | DNA polymerase III subunit theta | - |
NG826_RS06405 (NG826_06395) | 1362903..1363277 | + | 375 | WP_263794005.1 | copper homeostasis periplasmic binding protein CopC | - |
NG826_RS06410 (NG826_06400) | 1363282..1364157 | + | 876 | WP_263794006.1 | copper homeostasis membrane protein CopD | - |
NG826_RS06415 (NG826_06405) | 1364185..1364532 | + | 348 | WP_028723425.1 | YebY family protein | - |
- | 1364612..1364744 | - | 133 | - | - | Antitoxin |
- | 1364647..1364744 | + | 98 | - | - | Toxin |
NG826_RS06420 (NG826_06410) | 1364830..1364982 | - | 153 | Protein_1248 | site-specific integrase | - |
NG826_RS06425 (NG826_06415) | 1364981..1365082 | + | 102 | Protein_1249 | terminase | - |
NG826_RS06430 (NG826_06420) | 1365082..1365983 | + | 902 | Protein_1250 | phage portal protein | - |
NG826_RS06435 (NG826_06425) | 1366057..1367307 | - | 1251 | WP_263794007.1 | DUF4338 domain-containing protein | - |
NG826_RS06440 (NG826_06430) | 1367297..1367716 | - | 420 | WP_263794008.1 | ASCH domain-containing protein | - |
NG826_RS06445 (NG826_06435) | 1367727..1368950 | - | 1224 | WP_263794009.1 | hypothetical protein | - |
NG826_RS06450 (NG826_06440) | 1369097..1369596 | + | 500 | Protein_1254 | IS3-like element ISRaq1 family transposase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 98 bp
>T249089 NZ_CP099535:1364647-1364744 [Pantoea ananatis]
GCAAGGCGAAAGCCTCTATCAATGCCAACTTTTAGCGCACGGCTCCTTGAGAGCCATTTCCCTGGACCGAATACAGGAAT
CGTGTTCGGTCTTTTTTT
GCAAGGCGAAAGCCTCTATCAATGCCAACTTTTAGCGCACGGCTCCTTGAGAGCCATTTCCCTGGACCGAATACAGGAAT
CGTGTTCGGTCTTTTTTT
Antitoxin
Download Length: 133 bp
>AT249089 NZ_CP099535:c1364744-1364612 [Pantoea ananatis]
AAAAAAAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTCAAGGAGCCGTGCGCTAAAAGTTGGCATTGA
TAGAGGCTTTCGCCTTGCTTTTAAAGCGTAGGACAACGCGCCAGATTTTCCAG
AAAAAAAGACCGAACACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTCAAGGAGCCGTGCGCTAAAAGTTGGCATTGA
TAGAGGCTTTCGCCTTGCTTTTAAAGCGTAGGACAACGCGCCAGATTTTCCAG