Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2175038..2175180 | Replicon | chromosome |
Accession | NZ_CP099298 | ||
Organism | Citrobacter freundii strain RHB02-E3-C01 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2175073..2175176 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2175038..2175180 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NFJ20_RS10385 | 2171485..2172147 | - | 663 | WP_192468854.1 | exodeoxyribonuclease X | - |
NFJ20_RS10390 | 2172171..2172827 | - | 657 | WP_003034921.1 | carbon-nitrogen hydrolase family protein | - |
NFJ20_RS10395 | 2172934..2173164 | - | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
NFJ20_RS10400 | 2173308..2173682 | + | 375 | WP_003841654.1 | CopC domain-containing protein YobA | - |
NFJ20_RS10405 | 2173686..2174558 | + | 873 | WP_003034931.1 | copper homeostasis membrane protein CopD | - |
NFJ20_RS10410 | 2174579..2174917 | + | 339 | WP_003034934.1 | YebY family protein | - |
- | 2175038..2175180 | - | 143 | - | - | Antitoxin |
- | 2175073..2175176 | + | 104 | - | - | Toxin |
NFJ20_RS10415 | 2175254..2176339 | - | 1086 | WP_019076535.1 | phage integrase Arm DNA-binding domain-containing protein | - |
NFJ20_RS10420 | 2176308..2176580 | - | 273 | WP_032170291.1 | excisionase | - |
NFJ20_RS10425 | 2176644..2176886 | - | 243 | WP_001237028.1 | DUF4060 family protein | - |
NFJ20_RS10430 | 2176873..2177520 | - | 648 | WP_019076536.1 | hypothetical protein | - |
NFJ20_RS10435 | 2177513..2177857 | - | 345 | WP_019076537.1 | hypothetical protein | - |
NFJ20_RS10440 | 2177892..2178983 | - | 1092 | WP_199981214.1 | RecT family recombinase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2155204..2229567 | 74363 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T248323 NZ_CP099298:2175073-2175176 [Citrobacter freundii]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 143 bp
>AT248323 NZ_CP099298:c2175180-2175038 [Citrobacter freundii]
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
AGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT