Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2010117..2010262 | Replicon | chromosome |
| Accession | NZ_CP098831 | ||
| Organism | Salmonella enterica subsp. enterica serovar Indiana strain YZ20MCS14 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2010157..2010260 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2010117..2010262 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NFH10_RS09665 | 2006543..2007241 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NFH10_RS09670 | 2007265..2007921 | - | 657 | WP_023227121.1 | carbon-nitrogen hydrolase family protein | - |
| NFH10_RS09675 | 2008029..2008259 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NFH10_RS09680 | 2008397..2008771 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NFH10_RS09685 | 2008772..2009647 | + | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
| NFH10_RS09690 | 2009664..2010017 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2010117..2010262 | - | 146 | - | - | Antitoxin |
| - | 2010157..2010260 | + | 104 | - | - | Toxin |
| NFH10_RS09695 | 2010381..2011031 | - | 651 | Protein_1895 | tyrosine-type recombinase/integrase | - |
| NFH10_RS09700 | 2011301..2011507 | + | 207 | Protein_1896 | phage tail protein | - |
| NFH10_RS09705 | 2011592..2011834 | + | 243 | Protein_1897 | DUF4376 domain-containing protein | - |
| NFH10_RS09710 | 2011940..2012271 | + | 332 | Protein_1898 | DUF1353 domain-containing protein | - |
| NFH10_RS09715 | 2012320..2012429 | + | 110 | Protein_1899 | tail fiber assembly protein | - |
| NFH10_RS09720 | 2012520..2012705 | - | 186 | WP_071787785.1 | PagK family vesicle-borne virulence factor | - |
| NFH10_RS09725 | 2012957..2013145 | - | 189 | Protein_1901 | tail fiber assembly protein | - |
| NFH10_RS09730 | 2013141..2013911 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| NFH10_RS09740 | 2014401..2014529 | + | 129 | Protein_1903 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2004457..2026036 | 21579 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T248133 NZ_CP098831:2010157-2010260 [Salmonella enterica subsp. enterica serovar Indiana]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT248133 NZ_CP098831:c2010262-2010117 [Salmonella enterica subsp. enterica serovar Indiana]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
