Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1560940..1561086 | Replicon | chromosome |
Accession | NZ_CP098723 | ||
Organism | Yersinia ruckeri strain NVI-11065 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1560989..1561082 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1560940..1561086 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
ND444_RS07130 (ND444_07125) | 1556496..1557446 | + | 951 | WP_038243342.1 | prolyl aminopeptidase | - |
ND444_RS07135 (ND444_07130) | 1557569..1557799 | - | 231 | WP_038243344.1 | DNA polymerase III subunit theta | - |
ND444_RS07140 (ND444_07135) | 1558202..1558717 | + | 516 | WP_004721727.1 | non-heme ferritin | - |
ND444_RS07145 (ND444_07140) | 1559122..1559508 | + | 387 | WP_038243346.1 | CopC domain-containing protein YobA | - |
ND444_RS07150 (ND444_07145) | 1559510..1560394 | + | 885 | WP_004721723.1 | copper homeostasis membrane protein CopD | - |
ND444_RS07155 (ND444_07150) | 1560489..1560830 | + | 342 | WP_004721721.1 | YebY family protein | - |
- | 1560940..1561086 | - | 147 | - | - | Antitoxin |
- | 1560989..1561082 | + | 94 | - | - | Toxin |
ND444_RS07160 (ND444_07155) | 1561159..1562268 | - | 1110 | WP_265316651.1 | tyrosine-type recombinase/integrase | - |
ND444_RS07165 (ND444_07160) | 1562243..1562512 | - | 270 | WP_096823474.1 | excisionase | - |
ND444_RS07170 (ND444_07165) | 1562629..1562883 | - | 255 | WP_193553624.1 | hypothetical protein | - |
ND444_RS07175 (ND444_07170) | 1563074..1563247 | - | 174 | WP_170854680.1 | hypothetical protein | - |
ND444_RS07180 (ND444_07175) | 1563391..1564227 | - | 837 | WP_202976849.1 | hypothetical protein | - |
ND444_RS07185 (ND444_07180) | 1564292..1564720 | - | 429 | WP_267260653.1 | hypothetical protein | - |
ND444_RS07190 (ND444_07185) | 1564717..1565856 | - | 1140 | WP_096823472.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1554967..1618016 | 63049 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 94 bp
>T247903 NZ_CP098723:1560989-1561082 [Yersinia ruckeri]
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
Antitoxin
Download Length: 147 bp
>AT247903 NZ_CP098723:c1561086-1560940 [Yersinia ruckeri]
AGATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGTTG
GCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT
AGATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGTTG
GCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT