Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2122578..2122724 | Replicon | chromosome |
Accession | NZ_CP098716 | ||
Organism | Yersinia ruckeri strain NVI-11294 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2122582..2122675 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2122578..2122724 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
ND011_RS09735 (ND011_09725) | 2117808..2118947 | + | 1140 | WP_096823472.1 | hypothetical protein | - |
ND011_RS09740 (ND011_09730) | 2118944..2119372 | + | 429 | WP_096823473.1 | hypothetical protein | - |
ND011_RS09745 (ND011_09735) | 2119437..2120273 | + | 837 | WP_202976849.1 | hypothetical protein | - |
ND011_RS09750 (ND011_09740) | 2120417..2120590 | + | 174 | WP_170854680.1 | hypothetical protein | - |
ND011_RS09755 (ND011_09745) | 2120781..2121035 | + | 255 | WP_193553624.1 | hypothetical protein | - |
ND011_RS09760 (ND011_09750) | 2121152..2121421 | + | 270 | WP_096823474.1 | excisionase | - |
ND011_RS09765 (ND011_09755) | 2121396..2122505 | + | 1110 | WP_162486764.1 | tyrosine-type recombinase/integrase | - |
- | 2122578..2122724 | + | 147 | - | - | Antitoxin |
- | 2122582..2122675 | - | 94 | - | - | Toxin |
ND011_RS09770 (ND011_09760) | 2122834..2123175 | - | 342 | WP_004721721.1 | YebY family protein | - |
ND011_RS09775 (ND011_09765) | 2123270..2124154 | - | 885 | WP_004721723.1 | copper homeostasis membrane protein CopD | - |
ND011_RS09780 (ND011_09770) | 2124156..2124542 | - | 387 | WP_038243346.1 | CopC domain-containing protein YobA | - |
ND011_RS09785 (ND011_09775) | 2124947..2125462 | - | 516 | WP_004721727.1 | non-heme ferritin | - |
ND011_RS09790 (ND011_09780) | 2125865..2126095 | + | 231 | WP_038243344.1 | DNA polymerase III subunit theta | - |
ND011_RS09795 (ND011_09785) | 2126218..2127168 | - | 951 | WP_004721733.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2064656..2126095 | 61439 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 94 bp
>T247877 NZ_CP098716:c2122675-2122582 [Yersinia ruckeri]
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
Antitoxin
Download Length: 147 bp
>AT247877 NZ_CP098716:2122578-2122724 [Yersinia ruckeri]
AGATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGTTG
GCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT
AGATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGTTG
GCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT