Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2107658..2107804 | Replicon | chromosome |
Accession | NZ_CP098714 | ||
Organism | Yersinia ruckeri strain NVI-1176 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2107662..2107755 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2107658..2107804 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
ND442_RS09600 (ND442_09595) | 2102888..2104027 | + | 1140 | WP_096823472.1 | hypothetical protein | - |
ND442_RS09605 (ND442_09600) | 2104024..2104452 | + | 429 | WP_096823473.1 | hypothetical protein | - |
ND442_RS09610 (ND442_09605) | 2104517..2105353 | + | 837 | WP_202976849.1 | hypothetical protein | - |
ND442_RS09615 (ND442_09610) | 2105497..2105670 | + | 174 | WP_170854680.1 | hypothetical protein | - |
ND442_RS09620 (ND442_09615) | 2105861..2106115 | + | 255 | WP_193553624.1 | hypothetical protein | - |
ND442_RS09625 (ND442_09620) | 2106232..2106501 | + | 270 | WP_096823474.1 | excisionase | - |
ND442_RS09630 (ND442_09625) | 2106476..2107585 | + | 1110 | WP_162486764.1 | tyrosine-type recombinase/integrase | - |
- | 2107658..2107804 | + | 147 | - | - | Antitoxin |
- | 2107662..2107755 | - | 94 | - | - | Toxin |
ND442_RS09635 (ND442_09630) | 2107914..2108255 | - | 342 | WP_004721721.1 | YebY family protein | - |
ND442_RS09640 (ND442_09635) | 2108350..2109234 | - | 885 | WP_004721723.1 | copper homeostasis membrane protein CopD | - |
ND442_RS09645 (ND442_09640) | 2109236..2109622 | - | 387 | WP_038243346.1 | CopC domain-containing protein YobA | - |
ND442_RS09650 (ND442_09645) | 2110027..2110542 | - | 516 | WP_004721727.1 | non-heme ferritin | - |
ND442_RS09655 (ND442_09650) | 2110945..2111175 | + | 231 | WP_038243344.1 | DNA polymerase III subunit theta | - |
ND442_RS09660 (ND442_09655) | 2111298..2112248 | - | 951 | WP_004721733.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2037374..2113777 | 76403 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 94 bp
>T247866 NZ_CP098714:c2107755-2107662 [Yersinia ruckeri]
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
Antitoxin
Download Length: 147 bp
>AT247866 NZ_CP098714:2107658-2107804 [Yersinia ruckeri]
AGATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGTTG
GCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT
AGATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGTTG
GCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT