Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2078543..2078689 | Replicon | chromosome |
Accession | NZ_CP098711 | ||
Organism | Yersinia ruckeri strain NVI-1292 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2078547..2078640 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2078543..2078689 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
ND448_RS09385 (ND448_09375) | 2073773..2074912 | + | 1140 | WP_096823472.1 | hypothetical protein | - |
ND448_RS09390 (ND448_09380) | 2074909..2075337 | + | 429 | WP_096823473.1 | hypothetical protein | - |
ND448_RS09395 (ND448_09385) | 2075402..2076238 | + | 837 | WP_202976849.1 | hypothetical protein | - |
ND448_RS09400 (ND448_09390) | 2076382..2076555 | + | 174 | WP_170854680.1 | hypothetical protein | - |
ND448_RS09405 (ND448_09395) | 2076746..2077000 | + | 255 | WP_193553624.1 | hypothetical protein | - |
ND448_RS09410 (ND448_09400) | 2077117..2077386 | + | 270 | WP_096823474.1 | excisionase | - |
ND448_RS09415 (ND448_09405) | 2077361..2078470 | + | 1110 | WP_162486764.1 | tyrosine-type recombinase/integrase | - |
- | 2078543..2078689 | + | 147 | - | - | Antitoxin |
- | 2078547..2078640 | - | 94 | - | - | Toxin |
ND448_RS09420 (ND448_09410) | 2078799..2079140 | - | 342 | WP_004721721.1 | YebY family protein | - |
ND448_RS09425 (ND448_09415) | 2079235..2080119 | - | 885 | WP_004721723.1 | copper homeostasis membrane protein CopD | - |
ND448_RS09430 (ND448_09420) | 2080121..2080507 | - | 387 | WP_038243346.1 | CopC domain-containing protein YobA | - |
ND448_RS09435 (ND448_09425) | 2080912..2081427 | - | 516 | WP_004721727.1 | non-heme ferritin | - |
ND448_RS09440 (ND448_09430) | 2081830..2082060 | + | 231 | WP_038243344.1 | DNA polymerase III subunit theta | - |
ND448_RS09445 (ND448_09435) | 2082183..2083133 | - | 951 | WP_004721733.1 | prolyl aminopeptidase | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2008259..2079140 | 70881 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 94 bp
>T247855 NZ_CP098711:c2078640-2078547 [Yersinia ruckeri]
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
TAAGCCTGCATGAAATGCCAACTTTTAGCGCACGGCTCTATCCCAAGAGCCATTTCCCTGGACCGAATATAGGATTCGTA
TTCGGTCTTTTTTT
Antitoxin
Download Length: 147 bp
>AT247855 NZ_CP098711:2078543-2078689 [Yersinia ruckeri]
AGATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGTTG
GCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT
AGATAAAAAAAGACCGAATACGAATCCTATATTCGGTCCAGGGAAATGGCTCTTGGGATAGAGCCGTGCGCTAAAAGTTG
GCATTTCATGCAGGCTTATTAAGCCGTACCACTTAAGCGTAGTAGACGACCCACATTTTACCAATTT