Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2942451..2942591 | Replicon | chromosome |
Accession | NZ_CP097572 | ||
Organism | Enterobacter kobei strain C210239 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2942453..2942556 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2942451..2942591 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M8978_RS13990 (M8978_13990) | 2938542..2939700 | + | 1159 | Protein_2748 | RecT family recombinase | - |
M8978_RS13995 (M8978_13995) | 2939735..2940079 | + | 345 | WP_069721223.1 | hypothetical protein | - |
M8978_RS14000 (M8978_14000) | 2940072..2940755 | + | 684 | WP_190984050.1 | hypothetical protein | - |
M8978_RS14005 (M8978_14005) | 2940742..2940984 | + | 243 | WP_190984051.1 | DUF4060 family protein | - |
M8978_RS14010 (M8978_14010) | 2941049..2941321 | + | 273 | WP_190984052.1 | excisionase | - |
M8978_RS14015 (M8978_14015) | 2941290..2942375 | + | 1086 | WP_190984053.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2942451..2942591 | + | 141 | - | - | Antitoxin |
- | 2942453..2942556 | - | 104 | - | - | Toxin |
M8978_RS14020 (M8978_14020) | 2942695..2943033 | - | 339 | WP_014884299.1 | YebY family protein | - |
M8978_RS14025 (M8978_14025) | 2943050..2943919 | - | 870 | WP_045134189.1 | copper homeostasis membrane protein CopD | - |
M8978_RS14030 (M8978_14030) | 2943921..2944292 | - | 372 | WP_023338431.1 | CopC domain-containing protein YobA | - |
M8978_RS14035 (M8978_14035) | 2944430..2944660 | + | 231 | WP_013096102.1 | DNA polymerase III subunit theta | - |
M8978_RS14040 (M8978_14040) | 2944771..2945421 | + | 651 | WP_014884302.1 | carbon-nitrogen hydrolase family protein | - |
M8978_RS14045 (M8978_14045) | 2945446..2946108 | + | 663 | WP_014884303.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2892957..2964140 | 71183 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T245605 NZ_CP097572:c2942556-2942453 [Enterobacter kobei]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 141 bp
>AT245605 NZ_CP097572:2942451-2942591 [Enterobacter kobei]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT