Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1893209..1893349 | Replicon | chromosome |
Accession | NC_013850 | ||
Organism | Klebsiella variicola At-22 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1893245..1893347 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1893209..1893349 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KVAR_RS08820 | 1888339..1890399 | + | 2061 | WP_012967681.1 | oligopeptidase B | - |
KVAR_RS08825 | 1890403..1891062 | - | 660 | WP_008804267.1 | exodeoxyribonuclease X | - |
KVAR_RS08830 | 1891141..1891371 | - | 231 | WP_012541260.1 | DNA polymerase III subunit theta | - |
KVAR_RS08835 | 1891485..1891859 | + | 375 | WP_012967682.1 | CopC domain-containing protein YobA | - |
KVAR_RS08840 | 1891863..1892732 | + | 870 | WP_012541262.1 | copper homeostasis membrane protein CopD | - |
KVAR_RS08845 | 1892749..1893087 | + | 339 | WP_008804271.1 | YebY family protein | - |
- | 1893209..1893349 | - | 141 | - | - | Antitoxin |
- | 1893245..1893347 | + | 103 | - | - | Toxin |
KVAR_RS08850 | 1893425..1894510 | - | 1086 | WP_012967683.1 | phage integrase Arm DNA-binding domain-containing protein | - |
KVAR_RS26185 | 1894479..1894751 | - | 273 | WP_012967684.1 | excisionase | - |
KVAR_RS08855 | 1894927..1895124 | - | 198 | WP_012967685.1 | DNA polymerase III subunit theta | - |
KVAR_RS26190 | 1895544..1895738 | - | 195 | WP_032425654.1 | TraR/DksA family transcriptional regulator | - |
KVAR_RS08865 | 1895735..1896007 | - | 273 | WP_012967686.1 | DUF5405 family protein | - |
KVAR_RS08875 | 1896314..1896796 | - | 483 | WP_012967688.1 | siphovirus Gp157 family protein | - |
KVAR_RS08880 | 1896789..1897682 | - | 894 | WP_012967689.1 | recombinase RecT | - |
KVAR_RS08885 | 1897679..1897987 | - | 309 | WP_012967690.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1888372..1946448 | 58076 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T24548 NC_013850:1893245-1893347 [Klebsiella variicola At-22]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 141 bp
>AT24548 NC_013850:c1893349-1893209 [Klebsiella variicola At-22]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT