Detailed information of TA system
Overview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2693374..2693519 | Replicon | chromosome |
Accession | NZ_CP097262 | ||
Organism | Salmonella enterica subsp. enterica strain B3-6 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2693376..2693479 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2693374..2693519 (+) |
Genomic Context
Location: 2691904..2692182 (279 bp)
Type: Others
Protein ID: WP_001575998.1
Type: Others
Protein ID: WP_001575998.1
Location: 2692157..2693236 (1080 bp)
Type: Others
Protein ID: WP_000087636.1
Type: Others
Protein ID: WP_000087636.1
Location: 2693374..2693519 (146 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2695377..2695607 (231 bp)
Type: Others
Protein ID: WP_000856224.1
Type: Others
Protein ID: WP_000856224.1
Location: 2695715..2696371 (657 bp)
Type: Others
Protein ID: WP_000100257.1
Type: Others
Protein ID: WP_000100257.1
Location: 2696395..2697093 (699 bp)
Type: Others
Protein ID: WP_000944288.1
Type: Others
Protein ID: WP_000944288.1
Location: 2688574..2688792 (219 bp)
Type: Others
Protein ID: WP_001524708.1
Type: Others
Protein ID: WP_001524708.1
Location: 2689094..2689192 (99 bp)
Type: Others
Protein ID: WP_223151200.1
Type: Others
Protein ID: WP_223151200.1
Location: 2689511..2691490 (1980 bp)
Type: Others
Protein ID: WP_001237395.1
Type: Others
Protein ID: WP_001237395.1
Location: 2693376..2693479 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2693619..2693972 (354 bp)
Type: Others
Protein ID: WP_000722370.1
Type: Others
Protein ID: WP_000722370.1
Location: 2693989..2694864 (876 bp)
Type: Others
Protein ID: WP_000979694.1
Type: Others
Protein ID: WP_000979694.1
Location: 2694865..2695239 (375 bp)
Type: Others
Protein ID: WP_000168393.1
Type: Others
Protein ID: WP_000168393.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M3N94_RS13225 | 2688574..2688792 | - | 219 | WP_001524708.1 | hypothetical protein | - |
M3N94_RS13230 | 2689094..2689192 | - | 99 | WP_223151200.1 | hypothetical protein | - |
M3N94_RS13235 | 2689511..2691490 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
M3N94_RS13240 | 2691904..2692182 | + | 279 | WP_001575998.1 | excisionase | - |
M3N94_RS13245 | 2692157..2693236 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2693374..2693519 | + | 146 | - | - | Antitoxin |
- | 2693376..2693479 | - | 104 | - | - | Toxin |
M3N94_RS13250 | 2693619..2693972 | - | 354 | WP_000722370.1 | YebY family protein | - |
M3N94_RS13255 | 2693989..2694864 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
M3N94_RS13260 | 2694865..2695239 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
M3N94_RS13265 | 2695377..2695607 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
M3N94_RS13270 | 2695715..2696371 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
M3N94_RS13275 | 2696395..2697093 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2652401..2715389 | 62988 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T245078 NZ_CP097262:c2693479-2693376 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT245078 NZ_CP097262:2693374-2693519 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG