Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2187156..2187301 | Replicon | chromosome |
| Accession | NZ_CP096118 | ||
| Organism | Salmonella enterica subsp. enterica serovar Indiana strain 22 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2187196..2187299 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2187156..2187301 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MZK41_RS10705 | 2183582..2184280 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| MZK41_RS10710 | 2184304..2184960 | - | 657 | WP_023227121.1 | carbon-nitrogen hydrolase family protein | - |
| MZK41_RS10715 | 2185068..2185298 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MZK41_RS10720 | 2185436..2185810 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| MZK41_RS10725 | 2185811..2186686 | + | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
| MZK41_RS10730 | 2186703..2187056 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2187156..2187301 | - | 146 | - | - | Antitoxin |
| - | 2187196..2187299 | + | 104 | - | - | Toxin |
| MZK41_RS10735 | 2187420..2188070 | - | 651 | Protein_2103 | tyrosine-type recombinase/integrase | - |
| MZK41_RS10740 | 2188340..2188546 | + | 207 | Protein_2104 | phage tail protein | - |
| MZK41_RS10745 | 2188631..2188873 | + | 243 | Protein_2105 | DUF4376 domain-containing protein | - |
| MZK41_RS10750 | 2188979..2189310 | + | 332 | Protein_2106 | DUF1353 domain-containing protein | - |
| MZK41_RS10755 | 2189359..2189468 | + | 110 | Protein_2107 | tail fiber assembly protein | - |
| MZK41_RS10760 | 2189559..2189744 | - | 186 | WP_071787785.1 | PagK family vesicle-borne virulence factor | - |
| MZK41_RS10765 | 2189996..2190184 | - | 189 | Protein_2109 | tail fiber assembly protein | - |
| MZK41_RS10770 | 2190180..2190950 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| MZK41_RS10780 | 2191440..2191568 | + | 129 | Protein_2111 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2165288..2216001 | 50713 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T242752 NZ_CP096118:2187196-2187299 [Salmonella enterica subsp. enterica serovar Indiana]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT242752 NZ_CP096118:c2187301-2187156 [Salmonella enterica subsp. enterica serovar Indiana]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
