Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1973464..1973609 | Replicon | chromosome |
Accession | NZ_CP095557 | ||
Organism | Klebsiella pneumoniae strain BA11088 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1973500..1973602 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1973464..1973609 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MXX37_RS09585 | 1968594..1970654 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
MXX37_RS09590 | 1970658..1971317 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
MXX37_RS09595 | 1971396..1971626 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
MXX37_RS09600 | 1971739..1972113 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
MXX37_RS09605 | 1972117..1972986 | + | 870 | WP_004175431.1 | copper homeostasis membrane protein CopD | - |
MXX37_RS09610 | 1973003..1973341 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 1973464..1973609 | - | 146 | - | - | Antitoxin |
- | 1973500..1973602 | + | 103 | - | - | Toxin |
MXX37_RS09615 | 1973978..1974121 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
MXX37_RS09620 | 1974226..1975194 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
MXX37_RS09625 | 1975351..1976004 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
MXX37_RS09630 | 1976001..1976192 | - | 192 | WP_002911395.1 | YebW family protein | - |
MXX37_RS09635 | 1976290..1976529 | - | 240 | WP_002911393.1 | YebV family protein | - |
MXX37_RS09640 | 1976645..1978078 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1902901..1991006 | 88105 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T242411 NZ_CP095557:1973500-1973602 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT242411 NZ_CP095557:c1973609-1973464 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT