Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2058269..2058414 | Replicon | chromosome |
Accession | NZ_CP094451 | ||
Organism | Klebsiella pneumoniae subsp. rhinoscleromatis strain KP4831 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2058305..2058407 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2058269..2058414 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MRR30_RS10015 (MRR30_10015) | 2053399..2055459 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
MRR30_RS10020 (MRR30_10020) | 2055463..2056122 | - | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
MRR30_RS10025 (MRR30_10025) | 2056201..2056431 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
MRR30_RS10030 (MRR30_10030) | 2056544..2056918 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
MRR30_RS10035 (MRR30_10035) | 2056922..2057791 | + | 870 | WP_062955019.1 | copper homeostasis membrane protein CopD | - |
MRR30_RS10040 (MRR30_10040) | 2057808..2058146 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2058269..2058414 | - | 146 | - | - | Antitoxin |
- | 2058305..2058407 | + | 103 | - | - | Toxin |
MRR30_RS10045 (MRR30_10045) | 2058782..2058925 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
MRR30_RS10050 (MRR30_10050) | 2059030..2059998 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
MRR30_RS10055 (MRR30_10055) | 2060155..2060808 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
MRR30_RS10060 (MRR30_10060) | 2060805..2060996 | - | 192 | WP_002911395.1 | YebW family protein | - |
MRR30_RS10065 (MRR30_10065) | 2061094..2061333 | - | 240 | WP_002911393.1 | YebV family protein | - |
MRR30_RS10070 (MRR30_10070) | 2061449..2062882 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T239835 NZ_CP094451:2058305-2058407 [Klebsiella pneumoniae subsp. rhinoscleromatis]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT239835 NZ_CP094451:c2058414-2058269 [Klebsiella pneumoniae subsp. rhinoscleromatis]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT