Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2019266..2019411 | Replicon | chromosome |
| Accession | NZ_CP094332 | ||
| Organism | Salmonella enterica subsp. enterica strain 3018683606 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2019306..2019409 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2019266..2019411 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MQF88_RS09835 | 2015692..2016390 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| MQF88_RS09840 | 2016414..2017070 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| MQF88_RS09845 | 2017178..2017408 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MQF88_RS09850 | 2017546..2017920 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| MQF88_RS09855 | 2017921..2018796 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| MQF88_RS09860 | 2018813..2019166 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2019266..2019411 | - | 146 | - | - | Antitoxin |
| - | 2019306..2019409 | + | 104 | - | - | Toxin |
| MQF88_RS09865 | 2019540..2020463 | - | 924 | Protein_1930 | tyrosine-type recombinase/integrase | - |
| MQF88_RS09870 | 2020727..2021188 | - | 462 | Protein_1931 | DNA breaking-rejoining protein | - |
| MQF88_RS09875 | 2021177..2021368 | + | 192 | Protein_1932 | glycoside hydrolase family 19 protein | - |
| MQF88_RS09880 | 2021422..2021955 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| MQF88_RS09885 | 2022212..2022379 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| MQF88_RS09890 | 2022444..2022632 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| MQF88_RS09895 | 2022687..2022947 | + | 261 | Protein_1936 | DUF1441 family protein | - |
| MQF88_RS09900 | 2023162..2023506 | + | 345 | Protein_1937 | macro domain-containing protein | - |
| MQF88_RS09905 | 2023516..2023986 | + | 471 | Protein_1938 | tail fiber assembly protein | - |
| MQF88_RS09910 | 2024083..2024283 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | gtrB / gtrA / sopE2 | 2013606..2093199 | 79593 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T239674 NZ_CP094332:2019306-2019409 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT239674 NZ_CP094332:c2019411-2019266 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
