Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2561460..2561585 | Replicon | chromosome |
Accession | NC_012912 | ||
Organism | Dickeya zeae Ech1591 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2561462..2561552 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2561460..2561585 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
DD1591_RS11085 | 2556742..2556990 | - | 249 | WP_012769934.1 | GlsB/YeaQ/YmgE family stress response membrane protein | - |
DD1591_RS11090 | 2557326..2558015 | + | 690 | WP_012769935.1 | DNA/RNA non-specific endonuclease | - |
DD1591_RS11095 | 2558643..2559044 | - | 402 | WP_012769937.1 | hypothetical protein | - |
DD1591_RS21540 | 2559284..2559577 | - | 294 | WP_202959010.1 | DUF1364 family protein | - |
DD1591_RS11100 | 2560013..2560237 | + | 225 | WP_012769940.1 | hypothetical protein | - |
DD1591_RS11105 | 2560344..2560663 | - | 320 | Protein_2189 | IS1 family transposase | - |
DD1591_RS21545 | 2561163..2561297 | - | 135 | Protein_2190 | transposase | - |
- | 2561460..2561585 | + | 126 | - | - | Antitoxin |
- | 2561462..2561552 | - | 91 | - | - | Toxin |
DD1591_RS11115 | 2561713..2562051 | - | 339 | WP_012769943.1 | YebY family protein | - |
DD1591_RS11120 | 2562286..2562684 | + | 399 | WP_012769944.1 | hypothetical protein | - |
DD1591_RS11125 | 2562869..2563378 | - | 510 | WP_012769945.1 | non-heme ferritin | - |
DD1591_RS11130 | 2563636..2564511 | - | 876 | WP_012769946.1 | copper homeostasis membrane protein CopD | - |
DD1591_RS11135 | 2564536..2564916 | - | 381 | WP_012769947.1 | copper homeostasis periplasmic binding protein CopC | - |
DD1591_RS11140 | 2565078..2565308 | + | 231 | WP_012769948.1 | DNA polymerase III subunit theta | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 91 bp
>T23956 NC_012912:c2561552-2561462 [Dickeya chrysanthemi Ech1591]
GCCTGCAACAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGGGCACAGGAATCGTGTTC
GGTCTTTTTTT
GCCTGCAACAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGGGCACAGGAATCGTGTTC
GGTCTTTTTTT
Antitoxin
Download Length: 126 bp
>AT23956 NC_012912:2561460-2561585 [Dickeya chrysanthemi Ech1591]
ATAAAAAAAGACCGAACACGATTCCTGTGCCCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTGTTGCAGGCGTCATTTCCGCCTGCACTTTAAGCGTAGACGAC
ATAAAAAAAGACCGAACACGATTCCTGTGCCCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTGTTGCAGGCGTCATTTCCGCCTGCACTTTAAGCGTAGACGAC