Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 5418795..5418940 | Replicon | chromosome |
Accession | NZ_CP093854 | ||
Organism | Klebsiella pneumoniae strain Bio45 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 5418831..5418933 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 5418795..5418940 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MOQ73_RS26165 | 5413925..5415985 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
MOQ73_RS26170 | 5415989..5416648 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
MOQ73_RS26175 | 5416727..5416957 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
MOQ73_RS26180 | 5417070..5417444 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
MOQ73_RS26185 | 5417448..5418317 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
MOQ73_RS26190 | 5418334..5418672 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 5418795..5418940 | - | 146 | - | - | Antitoxin |
- | 5418831..5418933 | + | 103 | - | - | Toxin |
MOQ73_RS26195 | 5419309..5419452 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
MOQ73_RS26200 | 5419557..5420525 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
MOQ73_RS26205 | 5420682..5421335 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
MOQ73_RS26210 | 5421332..5421523 | - | 192 | WP_002911395.1 | YebW family protein | - |
MOQ73_RS26215 | 5421621..5421860 | - | 240 | WP_002911393.1 | YebV family protein | - |
MOQ73_RS26220 | 5421976..5423409 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Integrative and Conjugative Element | - | rfaE | 5360671..5607358 | 246687 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T238933 NZ_CP093854:5418831-5418933 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT238933 NZ_CP093854:c5418940-5418795 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT