Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 5361248..5361393 | Replicon | chromosome |
Accession | NZ_CP093852 | ||
Organism | Klebsiella pneumoniae strain Bio73 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 5361255..5361357 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 5361248..5361393 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MOQ71_RS25890 | 5356779..5358212 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
MOQ71_RS25895 | 5358328..5358567 | + | 240 | WP_002911393.1 | YebV family protein | - |
MOQ71_RS25900 | 5358665..5358856 | + | 192 | WP_002911395.1 | YebW family protein | - |
MOQ71_RS25905 | 5358853..5359506 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
MOQ71_RS25910 | 5359663..5360631 | + | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
MOQ71_RS25915 | 5360736..5360879 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 5361248..5361393 | + | 146 | - | - | Antitoxin |
- | 5361255..5361357 | - | 103 | - | - | Toxin |
MOQ71_RS25920 | 5361516..5361854 | - | 339 | WP_002911404.1 | YebY family protein | - |
MOQ71_RS25925 | 5361871..5362740 | - | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
MOQ71_RS25930 | 5362744..5363118 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
MOQ71_RS25935 | 5363231..5363461 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
MOQ71_RS25940 | 5363540..5364199 | + | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
MOQ71_RS25945 | 5364203..5366263 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Integrative and Conjugative Element | blaSHV-28 | kdsA / iroE | 5161741..5405379 | 243638 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T238908 NZ_CP093852:c5361357-5361255 [Klebsiella pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT238908 NZ_CP093852:5361248-5361393 [Klebsiella pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT