Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2749117..2749260 | Replicon | chromosome |
| Accession | NZ_CP093411 | ||
| Organism | Salmonella enterica subsp. enterica serovar Agona strain R18.0246 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2749119..2749222 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2749117..2749260 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MOP53_RS13380 | 2744539..2744808 | + | 270 | WP_077905753.1 | hypothetical protein | - |
| MOP53_RS13385 | 2744974..2745114 | + | 141 | WP_000489598.1 | hypothetical protein | - |
| MOP53_RS13390 | 2745260..2745802 | - | 543 | Protein_2629 | IS256 family transposase | - |
| MOP53_RS13395 | 2745822..2745914 | - | 93 | WP_231923105.1 | hypothetical protein | - |
| MOP53_RS13400 | 2745944..2748364 | - | 2421 | WP_024144813.1 | type III secretion system effector SspH3 | - |
| MOP53_RS13405 | 2748537..2748620 | - | 84 | Protein_2632 | phage tail protein | - |
| MOP53_RS13410 | 2748632..2748979 | + | 348 | Protein_2633 | tyrosine-type recombinase/integrase | - |
| - | 2749117..2749260 | + | 144 | - | - | Antitoxin |
| - | 2749119..2749222 | - | 104 | - | - | Toxin |
| MOP53_RS13415 | 2749362..2749715 | - | 354 | WP_000722368.1 | YebY family protein | - |
| MOP53_RS13420 | 2749732..2750607 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| MOP53_RS13425 | 2750608..2750982 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| MOP53_RS13430 | 2751120..2751350 | + | 231 | WP_000856227.1 | DNA polymerase III subunit theta | - |
| MOP53_RS13435 | 2751458..2752114 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| MOP53_RS13440 | 2752138..2752836 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2745260..2745937 | 677 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T238564 NZ_CP093411:c2749222-2749119 [Salmonella enterica subsp. enterica serovar Agona]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT238564 NZ_CP093411:2749117-2749260 [Salmonella enterica subsp. enterica serovar Agona]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
