Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2790740..2790883 | Replicon | chromosome |
| Accession | NZ_CP093405 | ||
| Organism | Salmonella enterica subsp. enterica serovar Agona strain R21.1368 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2790742..2790845 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2790740..2790883 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MOP56_RS13655 | 2786162..2786431 | + | 270 | WP_077905753.1 | hypothetical protein | - |
| MOP56_RS13660 | 2786597..2786737 | + | 141 | WP_000489598.1 | hypothetical protein | - |
| MOP56_RS13665 | 2786883..2787425 | - | 543 | Protein_2684 | IS256 family transposase | - |
| MOP56_RS13670 | 2787445..2787537 | - | 93 | WP_231923105.1 | hypothetical protein | - |
| MOP56_RS13675 | 2787567..2789987 | - | 2421 | WP_024144813.1 | type III secretion system effector SspH3 | - |
| MOP56_RS13680 | 2790160..2790243 | - | 84 | Protein_2687 | phage tail protein | - |
| MOP56_RS13685 | 2790255..2790602 | + | 348 | Protein_2688 | tyrosine-type recombinase/integrase | - |
| - | 2790740..2790883 | + | 144 | - | - | Antitoxin |
| - | 2790742..2790845 | - | 104 | - | - | Toxin |
| MOP56_RS13690 | 2790985..2791338 | - | 354 | WP_000722368.1 | YebY family protein | - |
| MOP56_RS13695 | 2791355..2792230 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| MOP56_RS13700 | 2792231..2792605 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| MOP56_RS13705 | 2792743..2792973 | + | 231 | WP_000856227.1 | DNA polymerase III subunit theta | - |
| MOP56_RS13710 | 2793081..2793737 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| MOP56_RS13715 | 2793761..2794459 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2786883..2787560 | 677 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T238518 NZ_CP093405:c2790845-2790742 [Salmonella enterica subsp. enterica serovar Agona]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT238518 NZ_CP093405:2790740-2790883 [Salmonella enterica subsp. enterica serovar Agona]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
