Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2776976..2777119 | Replicon | chromosome |
| Accession | NZ_CP093403 | ||
| Organism | Salmonella enterica subsp. enterica serovar Agona strain R21.1436 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2776978..2777081 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2776976..2777119 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MOP57_RS13575 | 2772398..2772667 | + | 270 | WP_077905753.1 | hypothetical protein | - |
| MOP57_RS13580 | 2772833..2772973 | + | 141 | WP_000489598.1 | hypothetical protein | - |
| MOP57_RS13585 | 2773119..2773661 | - | 543 | Protein_2667 | IS256 family transposase | - |
| MOP57_RS13590 | 2773681..2773773 | - | 93 | WP_231923105.1 | hypothetical protein | - |
| MOP57_RS13595 | 2773803..2776223 | - | 2421 | WP_024144813.1 | type III secretion system effector SspH3 | - |
| MOP57_RS13600 | 2776396..2776479 | - | 84 | Protein_2670 | phage tail protein | - |
| MOP57_RS13605 | 2776491..2776838 | + | 348 | Protein_2671 | tyrosine-type recombinase/integrase | - |
| - | 2776976..2777119 | + | 144 | - | - | Antitoxin |
| - | 2776978..2777081 | - | 104 | - | - | Toxin |
| MOP57_RS13610 | 2777221..2777574 | - | 354 | WP_000722368.1 | YebY family protein | - |
| MOP57_RS13615 | 2777591..2778466 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| MOP57_RS13620 | 2778467..2778841 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| MOP57_RS13625 | 2778979..2779209 | + | 231 | WP_000856227.1 | DNA polymerase III subunit theta | - |
| MOP57_RS13630 | 2779317..2779973 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| MOP57_RS13635 | 2779997..2780695 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2773119..2773796 | 677 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T238496 NZ_CP093403:c2777081-2776978 [Salmonella enterica subsp. enterica serovar Agona]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT238496 NZ_CP093403:2776976-2777119 [Salmonella enterica subsp. enterica serovar Agona]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
