Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2871776..2871919 | Replicon | chromosome |
| Accession | NZ_CP093402 | ||
| Organism | Salmonella enterica subsp. enterica serovar Agona strain R21.0464 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2871778..2871881 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2871776..2871919 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MOP58_RS14170 | 2867198..2867467 | + | 270 | WP_077905753.1 | hypothetical protein | - |
| MOP58_RS14175 | 2867633..2867773 | + | 141 | WP_000489598.1 | hypothetical protein | - |
| MOP58_RS14180 | 2867919..2868461 | - | 543 | Protein_2787 | IS256 family transposase | - |
| MOP58_RS14185 | 2868481..2868573 | - | 93 | WP_231923105.1 | hypothetical protein | - |
| MOP58_RS14190 | 2868603..2871023 | - | 2421 | WP_024144813.1 | type III secretion system effector SspH3 | - |
| MOP58_RS14195 | 2871196..2871279 | - | 84 | Protein_2790 | phage tail protein | - |
| MOP58_RS14200 | 2871291..2871638 | + | 348 | Protein_2791 | tyrosine-type recombinase/integrase | - |
| - | 2871776..2871919 | + | 144 | - | - | Antitoxin |
| - | 2871778..2871881 | - | 104 | - | - | Toxin |
| MOP58_RS14205 | 2872021..2872374 | - | 354 | WP_000722368.1 | YebY family protein | - |
| MOP58_RS14210 | 2872391..2873266 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| MOP58_RS14215 | 2873267..2873641 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| MOP58_RS14220 | 2873779..2874009 | + | 231 | WP_000856227.1 | DNA polymerase III subunit theta | - |
| MOP58_RS14225 | 2874117..2874773 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| MOP58_RS14230 | 2874797..2875495 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2867919..2868596 | 677 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T238474 NZ_CP093402:c2871881-2871778 [Salmonella enterica subsp. enterica serovar Agona]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT238474 NZ_CP093402:2871776-2871919 [Salmonella enterica subsp. enterica serovar Agona]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
