Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 3304392..3304537 | Replicon | chromosome |
Accession | NC_012731 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 3304399..3304501 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 3304392..3304537 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KP1_RS16220 | 3299924..3301357 | + | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
KP1_RS16225 | 3301473..3301712 | + | 240 | WP_002911393.1 | YebV family protein | - |
KP1_RS16230 | 3301810..3302001 | + | 192 | WP_002911395.1 | YebW family protein | - |
KP1_RS16235 | 3301998..3302651 | - | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KP1_RS16240 | 3302808..3303776 | + | 969 | WP_014907334.1 | VirK/YbjX family protein | - |
KP1_RS28870 | 3303881..3304024 | + | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
- | 3304392..3304537 | + | 146 | - | - | Antitoxin |
- | 3304399..3304501 | - | 103 | - | - | Toxin |
KP1_RS16250 | 3304660..3304998 | - | 339 | WP_002911404.1 | YebY family protein | - |
KP1_RS16255 | 3305015..3305884 | - | 870 | WP_014907333.1 | copper homeostasis membrane protein CopD | - |
KP1_RS16260 | 3305888..3306262 | - | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KP1_RS16265 | 3306375..3306605 | + | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KP1_RS16270 | 3306684..3307343 | + | 660 | WP_002911407.1 | exodeoxyribonuclease X | - |
KP1_RS16275 | 3307347..3309407 | - | 2061 | WP_004151449.1 | oligopeptidase B | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T23826 NC_012731:c3304501-3304399 [Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT23826 NC_012731:3304392-3304537 [Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT