Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 3485716..3485856 | Replicon | chromosome |
| Accession | NZ_CP093323 | ||
| Organism | Serratia plymuthica strain B37/06 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 3485716..3485812 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 3485716..3485856 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MNO11_RS16005 (MNO11_16005) | 3481056..3481904 | - | 849 | WP_241920959.1 | phage repressor protein CI | - |
| MNO11_RS16010 (MNO11_16010) | 3482018..3482377 | + | 360 | WP_241920960.1 | hypothetical protein | - |
| MNO11_RS16015 (MNO11_16015) | 3482442..3482675 | + | 234 | Protein_3152 | phage regulatory CII family protein | - |
| MNO11_RS16020 (MNO11_16020) | 3482764..3482919 | + | 156 | WP_241920961.1 | DUF2732 family protein | - |
| MNO11_RS16025 (MNO11_16025) | 3482919..3483098 | + | 180 | Protein_3154 | TraR/DksA C4-type zinc finger protein | - |
| MNO11_RS16030 (MNO11_16030) | 3483147..3483263 | + | 117 | WP_241922279.1 | hypothetical protein | - |
| MNO11_RS16035 (MNO11_16035) | 3483298..3484110 | + | 813 | WP_241920962.1 | toll/interleukin-1 receptor domain-containing protein | - |
| MNO11_RS16040 (MNO11_16040) | 3484185..3484778 | + | 594 | WP_241920963.1 | phage baseplate assembly protein V | - |
| MNO11_RS16045 (MNO11_16045) | 3484775..3485314 | + | 540 | WP_241920964.1 | GPW/gp25 family protein | - |
| MNO11_RS16050 (MNO11_16050) | 3485431..3485670 | + | 240 | Protein_3159 | tyrosine-type recombinase/integrase | - |
| - | 3485716..3485812 | - | 97 | - | - | Toxin |
| - | 3485716..3485856 | + | 141 | - | - | Antitoxin |
| MNO11_RS16055 (MNO11_16055) | 3485954..3486295 | - | 342 | WP_241920965.1 | YebY family protein | - |
| MNO11_RS16060 (MNO11_16060) | 3486365..3487246 | - | 882 | WP_197927547.1 | copper homeostasis membrane protein CopD | - |
| MNO11_RS16065 (MNO11_16065) | 3487250..3487633 | - | 384 | WP_013812465.1 | CopC domain-containing protein YobA | - |
| MNO11_RS16070 (MNO11_16070) | 3487938..3488456 | - | 519 | WP_004943119.1 | non-heme ferritin | - |
| MNO11_RS16075 (MNO11_16075) | 3488831..3489061 | + | 231 | WP_004943118.1 | DNA polymerase III subunit theta | - |
| MNO11_RS16080 (MNO11_16080) | 3489092..3490045 | - | 954 | WP_197927552.1 | prolyl aminopeptidase | - |
| MNO11_RS16085 (MNO11_16085) | 3490214..3490639 | - | 426 | WP_062870507.1 | TraR/DksA C4-type zinc finger protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 3474608..3490943 | 16335 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T238125 NZ_CP093323:c3485812-3485716 [Serratia plymuthica]
AACAAGCCCTGCACAAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCACAAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 141 bp
>AT238125 NZ_CP093323:3485716-3485856 [Serratia plymuthica]
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTTGTGCAGGGCTTGTTCAGCCATGCACTTTAAGAGTAGCTTACCGCGCTAGTTTTGCCAG
AAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGCAT
TTTGTGCAGGGCTTGTTCAGCCATGCACTTTAAGAGTAGCTTACCGCGCTAGTTTTGCCAG
