Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2870312..2870455 | Replicon | chromosome |
Accession | NZ_CP092861 | ||
Organism | Salmonella enterica strain P164045 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2870314..2870417 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2870312..2870455 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MLB75_RS14440 | 2866161..2866991 | + | 831 | WP_001534364.1 | recombination protein RecT | - |
MLB75_RS14445 | 2867026..2867259 | + | 234 | WP_000070063.1 | hypothetical protein | - |
MLB75_RS14450 | 2867256..2868098 | + | 843 | WP_000006437.1 | DNA adenine methylase | - |
MLB75_RS14455 | 2868086..2868265 | + | 180 | WP_000276802.1 | DUF1187 family protein | - |
MLB75_RS14460 | 2868555..2868779 | + | 225 | WP_001534361.1 | hypothetical protein | - |
MLB75_RS14465 | 2868852..2869124 | + | 273 | WP_031617245.1 | excisionase | - |
MLB75_RS14470 | 2869105..2870184 | + | 1080 | WP_241065596.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2870312..2870455 | + | 144 | - | - | Antitoxin |
- | 2870314..2870417 | - | 104 | - | - | Toxin |
MLB75_RS14475 | 2870558..2870911 | - | 354 | WP_000722368.1 | YebY family protein | - |
MLB75_RS14480 | 2870928..2871803 | - | 876 | WP_072103328.1 | copper homeostasis membrane protein CopD | - |
MLB75_RS14485 | 2871804..2872178 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
MLB75_RS14490 | 2872316..2872546 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
MLB75_RS14495 | 2872654..2873310 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
MLB75_RS14500 | 2873334..2874032 | + | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T237304 NZ_CP092861:c2870417-2870314 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTTTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTTTTTTT
Antitoxin
Download Length: 144 bp
>AT237304 NZ_CP092861:2870312-2870455 [Salmonella enterica]
ATAAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAAAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG