Detailed information of TA system
Overview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2186946..2187086 | Replicon | chromosome |
Accession | NZ_CP092466 | ||
Organism | Citrobacter portucalensis strain Cf7303 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2186981..2187084 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2186946..2187086 (-) |
Genomic Context
Location: 2185216..2185590 (375 bp)
Type: Others
Protein ID: WP_003833799.1
Type: Others
Protein ID: WP_003833799.1
Location: 2185594..2186466 (873 bp)
Type: Others
Protein ID: WP_008785042.1
Type: Others
Protein ID: WP_008785042.1
Location: 2186487..2186825 (339 bp)
Type: Others
Protein ID: WP_032943770.1
Type: Others
Protein ID: WP_032943770.1
Location: 2186981..2187084 (104 bp)
Type: Toxin
Protein ID: -
Type: Toxin
Protein ID: -
Location: 2183393..2184055 (663 bp)
Type: Others
Protein ID: WP_003833802.1
Type: Others
Protein ID: WP_003833802.1
Location: 2184079..2184735 (657 bp)
Type: Others
Protein ID: WP_008785043.1
Type: Others
Protein ID: WP_008785043.1
Location: 2184842..2185072 (231 bp)
Type: Others
Protein ID: WP_003034925.1
Type: Others
Protein ID: WP_003034925.1
Location: 2186946..2187086 (141 bp)
Type: Antitoxin
Protein ID: -
Type: Antitoxin
Protein ID: -
Location: 2187162..2188247 (1086 bp)
Type: Others
Protein ID: WP_071692209.1
Type: Others
Protein ID: WP_071692209.1
Location: 2188216..2188488 (273 bp)
Type: Others
Protein ID: WP_071692210.1
Type: Others
Protein ID: WP_071692210.1
Location: 2188553..2188795 (243 bp)
Type: Others
Protein ID: WP_065944795.1
Type: Others
Protein ID: WP_065944795.1
Location: 2188782..2188985 (204 bp)
Type: Others
Protein ID: WP_003841645.1
Type: Others
Protein ID: WP_003841645.1
Location: 2188978..2189322 (345 bp)
Type: Others
Protein ID: WP_171845942.1
Type: Others
Protein ID: WP_171845942.1
Location: 2189357..2190448 (1092 bp)
Type: Others
Protein ID: WP_071692475.1
Type: Others
Protein ID: WP_071692475.1
Loading, please wait
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LY264_RS10580 (LY264_10580) | 2183393..2184055 | - | 663 | WP_003833802.1 | exodeoxyribonuclease X | - |
LY264_RS10585 (LY264_10585) | 2184079..2184735 | - | 657 | WP_008785043.1 | carbon-nitrogen hydrolase family protein | - |
LY264_RS10590 (LY264_10590) | 2184842..2185072 | - | 231 | WP_003034925.1 | DNA polymerase III subunit theta | - |
LY264_RS10595 (LY264_10595) | 2185216..2185590 | + | 375 | WP_003833799.1 | CopC domain-containing protein YobA | - |
LY264_RS10600 (LY264_10600) | 2185594..2186466 | + | 873 | WP_008785042.1 | copper homeostasis membrane protein CopD | - |
LY264_RS10605 (LY264_10605) | 2186487..2186825 | + | 339 | WP_032943770.1 | YebY family protein | - |
- | 2186946..2187086 | - | 141 | - | - | Antitoxin |
- | 2186981..2187084 | + | 104 | - | - | Toxin |
LY264_RS10610 (LY264_10610) | 2187162..2188247 | - | 1086 | WP_071692209.1 | phage integrase Arm DNA-binding domain-containing protein | - |
LY264_RS10615 (LY264_10615) | 2188216..2188488 | - | 273 | WP_071692210.1 | excisionase | - |
LY264_RS10620 (LY264_10620) | 2188553..2188795 | - | 243 | WP_065944795.1 | DUF4060 family protein | - |
LY264_RS10625 (LY264_10625) | 2188782..2188985 | - | 204 | WP_003841645.1 | hypothetical protein | - |
LY264_RS10630 (LY264_10630) | 2188978..2189322 | - | 345 | WP_171845942.1 | hypothetical protein | - |
LY264_RS10635 (LY264_10635) | 2189357..2190448 | - | 1092 | WP_071692475.1 | RecT family recombinase | - |
Associated MGEs
Loading, please wait
MGE detail | Similar MGEs | Relative position | MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2181324..2249431 | 68107 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T236220 NZ_CP092466:2186981-2187084 [Citrobacter portucalensis]
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAGGGTAACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 141 bp
>AT236220 NZ_CP092466:c2187086-2186946 [Citrobacter portucalensis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAGTTACCCTGCCATTTAAGAATAGATGACAGCGCCAGGTTTTCCAGT