Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2664091..2664236 | Replicon | chromosome |
| Accession | NZ_CP092258 | ||
| Organism | Salmonella enterica subsp. enterica serovar Indiana strain 15 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2664093..2664196 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2664091..2664236 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MF259_RS12840 | 2659824..2659952 | - | 129 | Protein_2517 | helix-turn-helix domain-containing protein | - |
| MF259_RS12850 | 2660442..2661212 | + | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| MF259_RS12855 | 2661208..2661396 | + | 189 | Protein_2519 | tail fiber assembly protein | - |
| MF259_RS12860 | 2661648..2661833 | + | 186 | WP_071787785.1 | PagK family vesicle-borne virulence factor | - |
| MF259_RS12865 | 2661924..2662033 | - | 110 | Protein_2521 | tail fiber assembly protein | - |
| MF259_RS12870 | 2662082..2662413 | - | 332 | Protein_2522 | DUF1353 domain-containing protein | - |
| MF259_RS12875 | 2662519..2663052 | - | 534 | Protein_2523 | DUF4376 domain-containing protein | - |
| MF259_RS12880 | 2663322..2663972 | + | 651 | Protein_2524 | tyrosine-type recombinase/integrase | - |
| - | 2664091..2664236 | + | 146 | - | - | Antitoxin |
| - | 2664093..2664196 | - | 104 | - | - | Toxin |
| MF259_RS12885 | 2664336..2664689 | - | 354 | WP_000722368.1 | YebY family protein | - |
| MF259_RS12890 | 2664706..2665581 | - | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
| MF259_RS12895 | 2665582..2665956 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| MF259_RS12900 | 2666094..2666324 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MF259_RS12905 | 2666432..2667088 | + | 657 | WP_023227121.1 | carbon-nitrogen hydrolase family protein | - |
| MF259_RS12910 | 2667112..2667810 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2661982..2686104 | 24122 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T235832 NZ_CP092258:c2664196-2664093 [Salmonella enterica subsp. enterica serovar Indiana]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT235832 NZ_CP092258:2664091-2664236 [Salmonella enterica subsp. enterica serovar Indiana]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG