Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2074055..2074198 | Replicon | chromosome |
Accession | NZ_CP092075 | ||
Organism | Salmonella enterica strain P281972 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2074093..2074196 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2074055..2074198 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MC377_RS10330 | 2070479..2071177 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
MC377_RS10335 | 2071201..2071857 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
MC377_RS10340 | 2071965..2072195 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
MC377_RS10345 | 2072333..2072707 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
MC377_RS10350 | 2072708..2073583 | + | 876 | WP_000979691.1 | copper homeostasis membrane protein CopD | - |
MC377_RS10355 | 2073600..2073953 | + | 354 | WP_000722367.1 | YebY family protein | - |
- | 2074055..2074198 | - | 144 | - | - | Antitoxin |
- | 2074093..2074196 | + | 104 | - | - | Toxin |
MC377_RS10360 | 2074326..2075405 | - | 1080 | WP_086126941.1 | phage integrase Arm DNA-binding domain-containing protein | - |
MC377_RS10365 | 2075386..2075658 | - | 273 | WP_031617245.1 | excisionase | - |
MC377_RS10370 | 2075731..2075955 | - | 225 | WP_001534361.1 | hypothetical protein | - |
MC377_RS10375 | 2076245..2076430 | - | 186 | WP_001534356.1 | DUF1187 family protein | - |
MC377_RS10380 | 2076477..2077307 | - | 831 | WP_086126940.1 | recombination protein RecT | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sseI/srfH / sspH2 / sopE2 / sspH2 / sspH1 / sspH2 / sopE2 / sopE2 | 2000099..2163324 | 163225 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T235658 NZ_CP092075:2074093-2074196 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT235658 NZ_CP092075:c2074198-2074055 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG