Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2447419..2447562 | Replicon | chromosome |
| Accession | NZ_CP092040 | ||
| Organism | Salmonella enterica subsp. enterica serovar Infantis strain S19 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2447421..2447524 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2447419..2447562 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MCR19_RS11760 | 2442549..2442749 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| MCR19_RS11765 | 2442846..2443357 | - | 512 | Protein_2293 | tail fiber assembly protein | - |
| MCR19_RS11770 | 2443370..2443657 | - | 288 | Protein_2294 | macro domain-containing protein | - |
| MCR19_RS11775 | 2443667..2443882 | - | 216 | Protein_2295 | shikimate transporter | - |
| MCR19_RS11780 | 2443884..2444144 | - | 261 | Protein_2296 | DUF1441 family protein | - |
| MCR19_RS11785 | 2444452..2444619 | + | 168 | WP_000789529.1 | lytic enzyme | - |
| MCR19_RS11790 | 2444876..2445409 | - | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| MCR19_RS11795 | 2445463..2445654 | - | 192 | Protein_2299 | glycoside hydrolase family 19 protein | - |
| MCR19_RS11800 | 2445643..2446104 | + | 462 | Protein_2300 | DNA breaking-rejoining protein | - |
| MCR19_RS11805 | 2446368..2447261 | + | 894 | Protein_2301 | tyrosine-type recombinase/integrase | - |
| - | 2447419..2447562 | + | 144 | - | - | Antitoxin |
| - | 2447421..2447524 | - | 104 | - | - | Toxin |
| MCR19_RS11810 | 2447664..2448017 | - | 354 | WP_000722368.1 | YebY family protein | - |
| MCR19_RS11815 | 2448034..2448909 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| MCR19_RS11820 | 2448910..2449284 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| MCR19_RS11825 | 2449422..2449652 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MCR19_RS11830 | 2449760..2450416 | + | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| MCR19_RS11835 | 2450440..2451138 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2414913..2451138 | 36225 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T235555 NZ_CP092040:c2447524-2447421 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT235555 NZ_CP092040:2447419-2447562 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG