Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2097057..2097200 | Replicon | chromosome |
| Accession | NZ_CP092012 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky strain N12-0259 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2097095..2097198 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2097057..2097200 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MA624_RS10310 | 2093481..2094179 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| MA624_RS10315 | 2094203..2094859 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| MA624_RS10320 | 2094967..2095197 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MA624_RS10325 | 2095335..2095709 | + | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
| MA624_RS10330 | 2095710..2096585 | + | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
| MA624_RS10335 | 2096602..2096955 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2097057..2097200 | - | 144 | - | - | Antitoxin |
| - | 2097095..2097198 | + | 104 | - | - | Toxin |
| MA624_RS10340 | 2097329..2097676 | - | 348 | Protein_2023 | tyrosine-type recombinase/integrase | - |
| MA624_RS10345 | 2097688..2097771 | + | 84 | Protein_2024 | phage tail protein | - |
| MA624_RS10350 | 2097945..2099879 | + | 1935 | WP_024147907.1 | NEL-type E3 ubiquitin ligase domain-containing protein | - |
| MA624_RS10360 | 2100021..2100549 | + | 529 | Protein_2026 | transposase | - |
| MA624_RS10365 | 2100695..2100835 | - | 141 | WP_031607419.1 | hypothetical protein | - |
| MA624_RS10370 | 2101001..2101269 | - | 269 | Protein_2028 | hypothetical protein | - |
| MA624_RS10375 | 2101309..2101509 | + | 201 | WP_023223931.1 | hypothetical protein | - |
| MA624_RS10380 | 2101638..2102057 | + | 420 | WP_023205587.1 | GNAT family N-acetyltransferase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2100211..2100549 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T235471 NZ_CP092012:2097095-2097198 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT235471 NZ_CP092012:c2097200-2097057 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
