Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2062701..2062844 | Replicon | chromosome |
| Accession | NZ_CP092009 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky strain N12-0931 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2062739..2062842 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2062701..2062844 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MA811_RS10065 | 2059125..2059823 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| MA811_RS10070 | 2059847..2060503 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| MA811_RS10075 | 2060611..2060841 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MA811_RS10080 | 2060979..2061353 | + | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
| MA811_RS10085 | 2061354..2062229 | + | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
| MA811_RS10090 | 2062246..2062599 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2062701..2062844 | - | 144 | - | - | Antitoxin |
| - | 2062739..2062842 | + | 104 | - | - | Toxin |
| MA811_RS10095 | 2062973..2063320 | - | 348 | Protein_1975 | tyrosine-type recombinase/integrase | - |
| MA811_RS10100 | 2063332..2063415 | + | 84 | Protein_1976 | phage tail protein | - |
| MA811_RS10105 | 2063589..2065523 | + | 1935 | WP_024147907.1 | NEL-type E3 ubiquitin ligase domain-containing protein | - |
| MA811_RS10115 | 2065665..2066193 | + | 529 | Protein_1978 | transposase | - |
| MA811_RS10120 | 2066339..2066479 | - | 141 | WP_031607419.1 | hypothetical protein | - |
| MA811_RS10125 | 2066645..2066913 | - | 269 | Protein_1980 | hypothetical protein | - |
| MA811_RS10130 | 2066953..2067153 | + | 201 | WP_023223931.1 | hypothetical protein | - |
| MA811_RS10135 | 2067282..2067701 | + | 420 | WP_023205587.1 | GNAT family N-acetyltransferase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2065855..2066193 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T235450 NZ_CP092009:2062739-2062842 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT235450 NZ_CP092009:c2062844-2062701 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
