Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2031345..2031488 | Replicon | chromosome |
| Accession | NZ_CP091999 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky strain N16-1393 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2031383..2031486 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2031345..2031488 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MA802_RS09885 | 2027769..2028467 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| MA802_RS09890 | 2028491..2029147 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| MA802_RS09895 | 2029255..2029485 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MA802_RS09900 | 2029623..2029997 | + | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
| MA802_RS09905 | 2029998..2030873 | + | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
| MA802_RS09910 | 2030890..2031243 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2031345..2031488 | - | 144 | - | - | Antitoxin |
| - | 2031383..2031486 | + | 104 | - | - | Toxin |
| MA802_RS09915 | 2031617..2031964 | - | 348 | Protein_1937 | tyrosine-type recombinase/integrase | - |
| MA802_RS09920 | 2031976..2032059 | + | 84 | Protein_1938 | phage tail protein | - |
| MA802_RS09925 | 2032233..2034167 | + | 1935 | WP_024147907.1 | NEL-type E3 ubiquitin ligase domain-containing protein | - |
| MA802_RS09935 | 2034309..2034837 | + | 529 | Protein_1940 | transposase | - |
| MA802_RS09940 | 2034983..2035123 | - | 141 | WP_031607419.1 | hypothetical protein | - |
| MA802_RS09945 | 2035289..2035557 | - | 269 | Protein_1942 | hypothetical protein | - |
| MA802_RS09950 | 2035597..2035797 | + | 201 | WP_023223931.1 | hypothetical protein | - |
| MA802_RS09955 | 2035926..2036345 | + | 420 | WP_023205587.1 | GNAT family N-acetyltransferase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2034499..2034837 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T235408 NZ_CP091999:2031383-2031486 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT235408 NZ_CP091999:c2031488-2031345 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
