Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2100818..2100961 | Replicon | chromosome |
| Accession | NZ_CP091998 | ||
| Organism | Salmonella enterica subsp. enterica serovar Kentucky strain N18-2092 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2100856..2100959 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2100818..2100961 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MA840_RS10325 | 2097242..2097940 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| MA840_RS10330 | 2097964..2098620 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| MA840_RS10335 | 2098728..2098958 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MA840_RS10340 | 2099096..2099470 | + | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
| MA840_RS10345 | 2099471..2100346 | + | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
| MA840_RS10350 | 2100363..2100716 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2100818..2100961 | - | 144 | - | - | Antitoxin |
| - | 2100856..2100959 | + | 104 | - | - | Toxin |
| MA840_RS10355 | 2101090..2101437 | - | 348 | Protein_2030 | tyrosine-type recombinase/integrase | - |
| MA840_RS10360 | 2101449..2101532 | + | 84 | Protein_2031 | phage tail protein | - |
| MA840_RS10365 | 2101706..2103640 | + | 1935 | WP_024147907.1 | NEL-type E3 ubiquitin ligase domain-containing protein | - |
| MA840_RS10375 | 2103782..2104310 | + | 529 | Protein_2033 | transposase | - |
| MA840_RS10380 | 2104456..2104596 | - | 141 | WP_031607419.1 | hypothetical protein | - |
| MA840_RS10385 | 2104762..2105030 | - | 269 | Protein_2035 | hypothetical protein | - |
| MA840_RS10390 | 2105070..2105270 | + | 201 | WP_023223931.1 | hypothetical protein | - |
| MA840_RS10395 | 2105399..2105818 | + | 420 | WP_023205587.1 | GNAT family N-acetyltransferase | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | flank | IS/Tn | - | - | 2103972..2104310 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T235388 NZ_CP091998:2100856-2100959 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT235388 NZ_CP091998:c2100961-2100818 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG