Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1927727..1927870 | Replicon | chromosome |
Accession | NZ_CP091997 | ||
Organism | Salmonella enterica subsp. enterica serovar Kentucky strain N20-2289 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1927729..1927832 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1927727..1927870 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MA641_RS09275 | 1922870..1923289 | - | 420 | WP_023205587.1 | GNAT family N-acetyltransferase | - |
MA641_RS09280 | 1923418..1923618 | - | 201 | WP_023223931.1 | hypothetical protein | - |
MA641_RS09285 | 1923658..1923926 | + | 269 | Protein_1820 | hypothetical protein | - |
MA641_RS09290 | 1924092..1924232 | + | 141 | WP_031607419.1 | hypothetical protein | - |
MA641_RS09295 | 1924378..1924906 | - | 529 | Protein_1822 | transposase | - |
MA641_RS09300 | 1924926..1925018 | - | 93 | WP_230855586.1 | hypothetical protein | - |
MA641_RS09305 | 1925048..1926982 | - | 1935 | WP_024147907.1 | NEL-type E3 ubiquitin ligase domain-containing protein | - |
MA641_RS09310 | 1927156..1927239 | - | 84 | Protein_1825 | phage tail protein | - |
MA641_RS09315 | 1927251..1927598 | + | 348 | Protein_1826 | tyrosine-type recombinase/integrase | - |
- | 1927727..1927870 | + | 144 | - | - | Antitoxin |
- | 1927729..1927832 | - | 104 | - | - | Toxin |
MA641_RS09320 | 1927972..1928325 | - | 354 | WP_000722368.1 | YebY family protein | - |
MA641_RS09325 | 1928342..1929217 | - | 876 | WP_023223935.1 | copper homeostasis membrane protein CopD | - |
MA641_RS09330 | 1929218..1929592 | - | 375 | WP_023205606.1 | CopC domain-containing protein YobA | - |
MA641_RS09335 | 1929730..1929960 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
MA641_RS09340 | 1930068..1930724 | + | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
MA641_RS09345 | 1930748..1931446 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | flank | IS/Tn | - | - | 1924378..1924716 | 338 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T235369 NZ_CP091997:c1927832-1927729 [Salmonella enterica subsp. enterica serovar Kentucky]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT235369 NZ_CP091997:1927727-1927870 [Salmonella enterica subsp. enterica serovar Kentucky]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG