Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2009318..2009461 | Replicon | chromosome |
| Accession | NZ_CP091630 | ||
| Organism | Salmonella enterica strain 1147 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2009356..2009459 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2009318..2009461 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L5506_RS09590 | 2005742..2006440 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| L5506_RS09595 | 2006464..2007120 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| L5506_RS09600 | 2007228..2007458 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L5506_RS09605 | 2007596..2007970 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| L5506_RS09610 | 2007971..2008846 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| L5506_RS09615 | 2008863..2009216 | + | 354 | WP_126524015.1 | YebY family protein | - |
| - | 2009318..2009461 | - | 144 | - | - | Antitoxin |
| - | 2009356..2009459 | + | 104 | - | - | Toxin |
| L5506_RS09620 | 2009590..2010240 | - | 651 | Protein_1879 | tyrosine-type recombinase/integrase | - |
| L5506_RS09625 | 2010251..2010556 | + | 306 | WP_206519696.1 | hypothetical protein | - |
| L5506_RS09630 | 2010513..2010716 | + | 204 | Protein_1881 | phage tail protein | - |
| L5506_RS09635 | 2010888..2011043 | + | 156 | Protein_1882 | phage tail protein | - |
| L5506_RS09640 | 2011149..2011481 | + | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| L5506_RS09645 | 2011530..2011639 | + | 110 | Protein_1884 | tail fiber assembly protein | - |
| L5506_RS09650 | 2011730..2011915 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| L5506_RS09655 | 2012167..2012355 | - | 189 | Protein_1886 | tail fiber assembly protein | - |
| L5506_RS09660 | 2012351..2013121 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| L5506_RS09665 | 2013191..2013289 | + | 99 | Protein_1888 | DUF4113 domain-containing protein | - |
| L5506_RS09670 | 2013612..2013740 | + | 129 | Protein_1889 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2003654..2053442 | 49788 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T234119 NZ_CP091630:2009356-2009459 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT234119 NZ_CP091630:c2009461-2009318 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
