Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1973196..1973339 | Replicon | chromosome |
| Accession | NZ_CP091626 | ||
| Organism | Salmonella enterica strain 1165 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1973234..1973337 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1973196..1973339 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L5507_RS09340 | 1969620..1970318 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| L5507_RS09345 | 1970342..1970998 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| L5507_RS09350 | 1971106..1971336 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L5507_RS09355 | 1971474..1971848 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| L5507_RS09360 | 1971849..1972724 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| L5507_RS09365 | 1972741..1973094 | + | 354 | WP_126524015.1 | YebY family protein | - |
| - | 1973196..1973339 | - | 144 | - | - | Antitoxin |
| - | 1973234..1973337 | + | 104 | - | - | Toxin |
| L5507_RS09370 | 1973468..1974118 | - | 651 | Protein_1829 | tyrosine-type recombinase/integrase | - |
| L5507_RS09375 | 1974129..1974434 | + | 306 | WP_206519696.1 | hypothetical protein | - |
| L5507_RS09380 | 1974391..1974594 | + | 204 | Protein_1831 | phage tail protein | - |
| L5507_RS09385 | 1974766..1974921 | + | 156 | Protein_1832 | phage tail protein | - |
| L5507_RS09390 | 1975027..1975359 | + | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| L5507_RS09395 | 1975408..1975517 | + | 110 | Protein_1834 | tail fiber assembly protein | - |
| L5507_RS09400 | 1975608..1975793 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| L5507_RS09405 | 1976045..1976233 | - | 189 | Protein_1836 | tail fiber assembly protein | - |
| L5507_RS09410 | 1976229..1976999 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| L5507_RS09415 | 1977069..1977167 | + | 99 | Protein_1838 | DUF4113 domain-containing protein | - |
| L5507_RS09420 | 1977490..1977618 | + | 129 | Protein_1839 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1951324..2017328 | 66004 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T234100 NZ_CP091626:1973234-1973337 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT234100 NZ_CP091626:c1973339-1973196 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
